Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229030086:

Variant ID: vg0229030086 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29030086
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGCCGTTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATCTAGCAACGCGATTTAGCCGATACCGACAGAAACCCTAAAACGAGAAGCA[G/A]
CCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACATAGACATATGATAAATAGGTAGGCAAGTATATCATCCAAACCAGAACAATCCAAGAGATCG

Reverse complement sequence

CGATCTCTTGGATTGTTCTGGTTTGGATGATATACTTGCCTACCTATTTATCATATGTCTATGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGG[C/T]
TGCTTCTCGTTTTAGGGTTTCTGTCGGTATCGGCTAAATCGCGTTGCTAGATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAACGGCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	4.40%	0.02%	0.00%	NA
All Indica	2759	92.50%	7.50%	0.04%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	90.40%	9.40%	0.17%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	95.50%	4.50%	0.00%	0.00%	NA
Indica Intermediate	786	86.90%	13.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229030086	G -> A	LOC_Os02g47510.1	upstream_gene_variant ; 1827.0bp to feature; MODIFIER	silent_mutation	Average:33.581; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0229030086	G -> A	LOC_Os02g47520.1	upstream_gene_variant ; 3286.0bp to feature; MODIFIER	silent_mutation	Average:33.581; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0229030086	G -> A	LOC_Os02g47510-LOC_Os02g47520	intergenic_region ; MODIFIER	silent_mutation	Average:33.581; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229030086	NA	4.55E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086	1.24E-06	NA	mr1913	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086	6.98E-06	NA	mr1913	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086	NA	9.50E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086	NA	1.86E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086	NA	6.59E-11	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086	NA	3.20E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086	NA	6.01E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251