\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229030086:

Variant ID: vg0229030086 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29030086
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGCCGTTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATCTAGCAACGCGATTTAGCCGATACCGACAGAAACCCTAAAACGAGAAGCA[G/A]
CCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACATAGACATATGATAAATAGGTAGGCAAGTATATCATCCAAACCAGAACAATCCAAGAGATCG

Reverse complement sequence

CGATCTCTTGGATTGTTCTGGTTTGGATGATATACTTGCCTACCTATTTATCATATGTCTATGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGG[C/T]
TGCTTCTCGTTTTAGGGTTTCTGTCGGTATCGGCTAAATCGCGTTGCTAGATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAACGGCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.40% 0.02% 0.00% NA
All Indica  2759 92.50% 7.50% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.40% 9.40% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 95.50% 4.50% 0.00% 0.00% NA
Indica Intermediate  786 86.90% 13.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229030086 G -> A LOC_Os02g47510.1 upstream_gene_variant ; 1827.0bp to feature; MODIFIER silent_mutation Average:33.581; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0229030086 G -> A LOC_Os02g47520.1 upstream_gene_variant ; 3286.0bp to feature; MODIFIER silent_mutation Average:33.581; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0229030086 G -> A LOC_Os02g47510-LOC_Os02g47520 intergenic_region ; MODIFIER silent_mutation Average:33.581; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229030086 NA 4.55E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086 1.24E-06 NA mr1913 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086 6.98E-06 NA mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086 NA 9.50E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086 NA 1.86E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086 NA 6.59E-11 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086 NA 3.20E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229030086 NA 6.01E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251