Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228634958:

Variant ID: vg0228634958 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28634958
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGTTGTAAAGATTTAATTAAAACAAATACAATGGTGTGATCGGATCATATATTGCATAAGTAATTTAAGAGAAAAATCATTTTGAAACTTAGTAAAAT[A/C]
CATGCATGTGTGTATGGATGAGGTGAAGAGAGAGGAGGGAGAGAGTAGTAGCAGGTAGTATCAGGAATTTTGTGAAACACACTGAACACGCACATTGAAA

Reverse complement sequence

TTTCAATGTGCGTGTTCAGTGTGTTTCACAAAATTCCTGATACTACCTGCTACTACTCTCTCCCTCCTCTCTCTTCACCTCATCCATACACACATGCATG[T/G]
ATTTTACTAAGTTTCAAAATGATTTTTCTCTTAAATTACTTATGCAATATATGATCCGATCACACCATTGTATTTGTTTTAATTAAATCTTTACAACAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 28.90% 1.97% 0.00% NA
All Indica  2759 90.90% 9.00% 0.11% 0.00% NA
All Japonica  1512 43.10% 51.30% 5.69% 0.00% NA
Aus  269 21.20% 78.10% 0.74% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 94.40% 5.40% 0.22% 0.00% NA
Indica III  913 87.00% 13.00% 0.00% 0.00% NA
Indica Intermediate  786 87.20% 12.60% 0.25% 0.00% NA
Temperate Japonica  767 54.00% 38.30% 7.69% 0.00% NA
Tropical Japonica  504 27.80% 68.50% 3.77% 0.00% NA
Japonica Intermediate  241 40.20% 56.40% 3.32% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228634958 A -> C LOC_Os02g46920.1 upstream_gene_variant ; 2562.0bp to feature; MODIFIER silent_mutation Average:68.063; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N
vg0228634958 A -> C LOC_Os02g46920-LOC_Os02g46930 intergenic_region ; MODIFIER silent_mutation Average:68.063; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0228634958 A C -0.02 0.02 0.04 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228634958 NA 4.59E-18 mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228634958 NA 9.00E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228634958 NA 1.04E-12 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228634958 NA 2.34E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228634958 NA 1.51E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228634958 NA 1.24E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251