\
| Variant ID: vg0228581225 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28581225 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 117. )
TGGACGCGGAAGTCGAGGACGGTGCGACCAGCGGCAATGGATGGATGCGAAGAACAGGATCAACACAACCGGTGTCCGTGAGCTAGCTCCGTAATCACCG[G/A]
TTGCCTAGCTCCATTTGCACAACCGAAGACTTTGAATGGCATGTCAAAAAAAAAAAAGAAGATTGGACCCAAAAACAATTAATCTGAATGCCATGTCATT
AATGACATGGCATTCAGATTAATTGTTTTTGGGTCCAATCTTCTTTTTTTTTTTTGACATGCCATTCAAAGTCTTCGGTTGTGCAAATGGAGCTAGGCAA[C/T]
CGGTGATTACGGAGCTAGCTCACGGACACCGGTTGTGTTGATCCTGTTCTTCGCATCCATCCATTGCCGCTGGTCGCACCGTCCTCGACTTCCGCGTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 2.40% | 3.87% | 42.98% | NA |
| All Indica | 2759 | 16.70% | 4.10% | 6.56% | 72.64% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 11.40% | 1.80% | 3.36% | 83.36% | NA |
| Indica II | 465 | 8.00% | 4.30% | 5.38% | 82.37% | NA |
| Indica III | 913 | 20.50% | 4.80% | 8.00% | 66.70% | NA |
| Indica Intermediate | 786 | 21.50% | 4.80% | 8.02% | 65.65% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 0.00% | 2.22% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228581225 | G -> A | LOC_Os02g46839.1 | upstream_gene_variant ; 335.0bp to feature; MODIFIER | silent_mutation | Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 | N | N | N | N |
| vg0228581225 | G -> A | LOC_Os02g46820.1 | downstream_gene_variant ; 4468.0bp to feature; MODIFIER | silent_mutation | Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 | N | N | N | N |
| vg0228581225 | G -> A | LOC_Os02g46830.1 | downstream_gene_variant ; 2049.0bp to feature; MODIFIER | silent_mutation | Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 | N | N | N | N |
| vg0228581225 | G -> A | LOC_Os02g46850.1 | downstream_gene_variant ; 321.0bp to feature; MODIFIER | silent_mutation | Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 | N | N | N | N |
| vg0228581225 | G -> A | LOC_Os02g46860.1 | downstream_gene_variant ; 4078.0bp to feature; MODIFIER | silent_mutation | Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 | N | N | N | N |
| vg0228581225 | G -> A | LOC_Os02g46830-LOC_Os02g46850 | intergenic_region ; MODIFIER | silent_mutation | Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 | N | N | N | N |
| vg0228581225 | G -> DEL | N | N | silent_mutation | Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228581225 | NA | 1.20E-26 | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.08E-54 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 1.67E-51 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 6.13E-38 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.33E-36 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.27E-50 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 1.78E-36 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.49E-45 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 1.37E-49 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 4.82E-43 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 4.94E-28 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 1.05E-29 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.44E-30 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 4.82E-25 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 1.42E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.55E-29 | mr1426 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.26E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 3.96E-15 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.70E-51 | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 4.15E-51 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 4.85E-38 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 3.36E-51 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 6.99E-23 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 6.71E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 3.53E-21 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 2.03E-35 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 1.23E-31 | mr1244_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 4.49E-07 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 7.84E-19 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 8.51E-25 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 7.01E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 3.74E-11 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228581225 | NA | 6.00E-18 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |