\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228581225:

Variant ID: vg0228581225 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28581225
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACGCGGAAGTCGAGGACGGTGCGACCAGCGGCAATGGATGGATGCGAAGAACAGGATCAACACAACCGGTGTCCGTGAGCTAGCTCCGTAATCACCG[G/A]
TTGCCTAGCTCCATTTGCACAACCGAAGACTTTGAATGGCATGTCAAAAAAAAAAAAGAAGATTGGACCCAAAAACAATTAATCTGAATGCCATGTCATT

Reverse complement sequence

AATGACATGGCATTCAGATTAATTGTTTTTGGGTCCAATCTTCTTTTTTTTTTTTGACATGCCATTCAAAGTCTTCGGTTGTGCAAATGGAGCTAGGCAA[C/T]
CGGTGATTACGGAGCTAGCTCACGGACACCGGTTGTGTTGATCCTGTTCTTCGCATCCATCCATTGCCGCTGGTCGCACCGTCCTCGACTTCCGCGTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 2.40% 3.87% 42.98% NA
All Indica  2759 16.70% 4.10% 6.56% 72.64% NA
All Japonica  1512 99.70% 0.00% 0.00% 0.26% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 11.40% 1.80% 3.36% 83.36% NA
Indica II  465 8.00% 4.30% 5.38% 82.37% NA
Indica III  913 20.50% 4.80% 8.00% 66.70% NA
Indica Intermediate  786 21.50% 4.80% 8.02% 65.65% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 0.00% 2.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228581225 G -> A LOC_Os02g46839.1 upstream_gene_variant ; 335.0bp to feature; MODIFIER silent_mutation Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 N N N N
vg0228581225 G -> A LOC_Os02g46820.1 downstream_gene_variant ; 4468.0bp to feature; MODIFIER silent_mutation Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 N N N N
vg0228581225 G -> A LOC_Os02g46830.1 downstream_gene_variant ; 2049.0bp to feature; MODIFIER silent_mutation Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 N N N N
vg0228581225 G -> A LOC_Os02g46850.1 downstream_gene_variant ; 321.0bp to feature; MODIFIER silent_mutation Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 N N N N
vg0228581225 G -> A LOC_Os02g46860.1 downstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 N N N N
vg0228581225 G -> A LOC_Os02g46830-LOC_Os02g46850 intergenic_region ; MODIFIER silent_mutation Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 N N N N
vg0228581225 G -> DEL N N silent_mutation Average:77.074; most accessible tissue: Minghui63 root, score: 85.968 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228581225 NA 1.20E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.08E-54 mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 1.67E-51 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 6.13E-38 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.33E-36 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.27E-50 mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 1.78E-36 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.49E-45 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 1.37E-49 mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 4.82E-43 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 4.94E-28 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 1.05E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.44E-30 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 4.82E-25 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 1.42E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.55E-29 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.26E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 3.96E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.70E-51 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 4.15E-51 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 4.85E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 3.36E-51 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 6.99E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 6.71E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 3.53E-21 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 2.03E-35 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 1.23E-31 mr1244_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 4.49E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 7.84E-19 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 8.51E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 7.01E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 3.74E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228581225 NA 6.00E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251