Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228555399:

Variant ID: vg0228555399 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28555399
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTAAAGGAGGAATTCCCTCCCAATTACCTGCCCCTACCCAGGTATTGAAAATGAGGGAGTTTCTTCCTCAATTCCCCATCCCCATCCCACCAAAATTC[C/T]
CATGTCTCCCAACCAAACAAAACACTTAATAGCATCATCCCTCTAAACTCCCAATCTCTCCTAAAAACTCCCTCCAACCAAACGGGCCGTCAAGGTCCTA

Reverse complement sequence

TAGGACCTTGACGGCCCGTTTGGTTGGAGGGAGTTTTTAGGAGAGATTGGGAGTTTAGAGGGATGATGCTATTAAGTGTTTTGTTTGGTTGGGAGACATG[G/A]
GAATTTTGGTGGGATGGGGATGGGGAATTGAGGAAGAAACTCCCTCATTTTCAATACCTGGGTAGGGGCAGGTAATTGGGAGGGAATTCCTCCTTTACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.70% 0.28% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 85.80% 13.40% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 87.90% 12.10% 0.00% 0.00% NA
Tropical Japonica  504 80.60% 17.30% 2.18% 0.00% NA
Japonica Intermediate  241 90.50% 9.10% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228555399 C -> T LOC_Os02g46750.1 upstream_gene_variant ; 3515.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46770.1 upstream_gene_variant ; 395.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46750.2 upstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46750.3 upstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46750.5 upstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46750.4 upstream_gene_variant ; 3515.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46760.1 downstream_gene_variant ; 1638.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46780.1 downstream_gene_variant ; 2687.0bp to feature; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0228555399 C -> T LOC_Os02g46760-LOC_Os02g46770 intergenic_region ; MODIFIER silent_mutation Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228555399 7.84E-07 NA mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 8.25E-06 8.25E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 1.72E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 9.35E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 4.93E-06 mr1386_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 5.00E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 8.87E-07 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 1.35E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 7.08E-06 2.19E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 2.41E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 8.05E-07 1.53E-08 mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 1.00E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 8.10E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 NA 5.62E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228555399 4.23E-06 NA mr1942_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251