\
| Variant ID: vg0228554225 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28554225 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
AAAACTATTTTAAACTATTTTTTCTCTTAAATTATTTATCCAAATCATGATCCGATTGCACTGTTAAATTCGTTGCAATTAAATCTTTAAAACAAGACCA[C/T]
ACATGGATATATTCCGATAAAAAATTAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCAACAAGTATATCGGAATTGTTTCACTAACTAGA
TCTAGTTAGTGAAACAATTCCGATATACTTGTTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTAATTTTTTATCGGAATATATCCATGT[G/A]
TGGTCTTGTTTTAAAGATTTAATTGCAACGAATTTAACAGTGCAATCGGATCATGATTTGGATAAATAATTTAAGAGAAAAAATAGTTTAAAATAGTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 6.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 82.50% | 17.10% | 0.33% | 0.00% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.60% | 45.60% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228554225 | C -> T | LOC_Os02g46750.1 | upstream_gene_variant ; 2341.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46770.1 | upstream_gene_variant ; 1569.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46750.2 | upstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46750.3 | upstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46750.5 | upstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46750.4 | upstream_gene_variant ; 2341.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46760.1 | downstream_gene_variant ; 464.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46780.1 | downstream_gene_variant ; 3861.0bp to feature; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| vg0228554225 | C -> T | LOC_Os02g46760-LOC_Os02g46770 | intergenic_region ; MODIFIER | silent_mutation | Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228554225 | NA | 2.64E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 1.10E-10 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 2.49E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 5.08E-12 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 1.78E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 7.93E-11 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 4.25E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 5.77E-13 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 9.99E-14 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 7.39E-06 | NA | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 1.13E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 5.99E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 9.63E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 9.96E-17 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 8.96E-14 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 7.85E-08 | NA | mr1241_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 2.21E-10 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 6.34E-07 | NA | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 5.12E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 1.60E-15 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | 2.27E-06 | 1.03E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 8.35E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 2.52E-15 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 6.15E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 5.28E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 1.28E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 1.53E-11 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228554225 | NA | 5.42E-10 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |