\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228554225:

Variant ID: vg0228554225 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28554225
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACTATTTTAAACTATTTTTTCTCTTAAATTATTTATCCAAATCATGATCCGATTGCACTGTTAAATTCGTTGCAATTAAATCTTTAAAACAAGACCA[C/T]
ACATGGATATATTCCGATAAAAAATTAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCAACAAGTATATCGGAATTGTTTCACTAACTAGA

Reverse complement sequence

TCTAGTTAGTGAAACAATTCCGATATACTTGTTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTAATTTTTTATCGGAATATATCCATGT[G/A]
TGGTCTTGTTTTAAAGATTTAATTGCAACGAATTTAACAGTGCAATCGGATCATGATTTGGATAAATAATTTAAGAGAAAAAATAGTTTAAAATAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.60% 0.11% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 82.50% 17.10% 0.33% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 53.60% 45.60% 0.79% 0.00% NA
Japonica Intermediate  241 92.10% 7.50% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228554225 C -> T LOC_Os02g46750.1 upstream_gene_variant ; 2341.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46770.1 upstream_gene_variant ; 1569.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46750.2 upstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46750.3 upstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46750.5 upstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46750.4 upstream_gene_variant ; 2341.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46760.1 downstream_gene_variant ; 464.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46780.1 downstream_gene_variant ; 3861.0bp to feature; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N
vg0228554225 C -> T LOC_Os02g46760-LOC_Os02g46770 intergenic_region ; MODIFIER silent_mutation Average:59.541; most accessible tissue: Zhenshan97 flower, score: 74.708 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228554225 NA 2.64E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 1.10E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 2.49E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 5.08E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 1.78E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 7.93E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 4.25E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 5.77E-13 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 9.99E-14 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 7.39E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 1.13E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 5.99E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 9.63E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 9.96E-17 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 8.96E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 7.85E-08 NA mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 2.21E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 6.34E-07 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 5.12E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 1.60E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 2.27E-06 1.03E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 8.35E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 2.52E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 6.15E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 5.28E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 1.28E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 1.53E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228554225 NA 5.42E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251