\
| Variant ID: vg0228543492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28543492 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCCCACTCAAGAGTTAAAAAAAAAAGAGCCTACTCAAGAGTTAAAACAAAAAGATTTGGAGGGAGAGACATCCCTCCAAACACTTTTTAGGAAGAAATT[G/A]
TGAGCGTATTAAAGATTGAACATGAGACCTCGAAATTGAAACCACACACTTCTTACCATTGCACTATCAAGTGCATCTCATGACCCATTCAAAAGTTGGA
TCCAACTTTTGAATGGGTCATGAGATGCACTTGATAGTGCAATGGTAAGAAGTGTGTGGTTTCAATTTCGAGGTCTCATGTTCAATCTTTAATACGCTCA[C/T]
AATTTCTTCCTAAAAAGTGTTTGGAGGGATGTCTCTCCCTCCAAATCTTTTTGTTTTAACTCTTGAGTAGGCTCTTTTTTTTTTAACTCTTGAGTGGGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 5.90% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 84.90% | 14.50% | 0.60% | 0.00% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 60.70% | 38.10% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 6.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228543492 | G -> A | LOC_Os02g46740.1 | upstream_gene_variant ; 1682.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| vg0228543492 | G -> A | LOC_Os02g46730.1 | downstream_gene_variant ; 468.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| vg0228543492 | G -> A | LOC_Os02g46750.1 | downstream_gene_variant ; 4859.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| vg0228543492 | G -> A | LOC_Os02g46750.2 | downstream_gene_variant ; 4859.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| vg0228543492 | G -> A | LOC_Os02g46750.3 | downstream_gene_variant ; 4859.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| vg0228543492 | G -> A | LOC_Os02g46750.5 | downstream_gene_variant ; 4859.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| vg0228543492 | G -> A | LOC_Os02g46750.4 | downstream_gene_variant ; 4859.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| vg0228543492 | G -> A | LOC_Os02g46730-LOC_Os02g46740 | intergenic_region ; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 79.469 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228543492 | NA | 8.04E-11 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 2.08E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.43E-11 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 6.73E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 4.12E-12 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.20E-12 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.98E-11 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.44E-11 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.17E-12 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | 9.05E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 7.06E-13 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 2.21E-09 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.10E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.18E-13 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 2.67E-17 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.33E-14 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | 7.08E-07 | NA | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.50E-11 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | 1.99E-06 | NA | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.31E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | 7.13E-06 | NA | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 6.06E-16 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.19E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.35E-07 | mr1408_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.28E-15 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.66E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 7.44E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 2.47E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 1.27E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.83E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 2.86E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 6.04E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 3.42E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 4.29E-09 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 2.29E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 4.62E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 9.26E-11 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 5.37E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 6.02E-12 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228543492 | NA | 2.49E-10 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |