\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228497476:

Variant ID: vg0228497476 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28497476
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AACGATCTACTACTGCCCGCAACGCCTTCAATGCCCCTCACCAACCCTAATAACTTCCCGGCGCCGCCCCGCCCTATCTACTCACCCGACCGTCCTACGT[T/G]
TGCTTCCCTGTCTACCGGCCGTCGTTAATCCTCTCCTCTCCGATCGCTTCTCAGTTTGGGATTTTCTTTTTCCCCTTTCGCTTCACGTGAACGGCCGGCA

Reverse complement sequence

TGCCGGCCGTTCACGTGAAGCGAAAGGGGAAAAAGAAAATCCCAAACTGAGAAGCGATCGGAGAGGAGAGGATTAACGACGGCCGGTAGACAGGGAAGCA[A/C]
ACGTAGGACGGTCGGGTGAGTAGATAGGGCGGGGCGGCGCCGGGAAGTTATTAGGGTTGGTGAGGGGCATTGAAGGCGTTGCGGGCAGTAGTAGATCGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 38.60% 0.59% 0.00% NA
All Indica  2759 90.20% 9.10% 0.76% 0.00% NA
All Japonica  1512 19.70% 80.00% 0.26% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 93.50% 6.00% 0.43% 0.00% NA
Indica III  913 87.00% 12.40% 0.66% 0.00% NA
Indica Intermediate  786 85.40% 13.20% 1.40% 0.00% NA
Temperate Japonica  767 9.80% 89.80% 0.39% 0.00% NA
Tropical Japonica  504 39.50% 60.30% 0.20% 0.00% NA
Japonica Intermediate  241 10.00% 90.00% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228497476 T -> G LOC_Os02g46680.1 intron_variant ; MODIFIER silent_mutation Average:87.102; most accessible tissue: Zhenshan97 flower, score: 96.107 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0228497476 T G -0.05 -0.01 -0.01 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228497476 NA 1.58E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 9.39E-14 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 3.70E-06 NA mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 2.18E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 1.91E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 9.07E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 5.23E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 1.24E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 1.11E-23 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 9.04E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 4.20E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 1.21E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476 NA 3.26E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251