Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228484792:

Variant ID: vg0228484792 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28484792
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGGCGATGGGAGTTGGCTGCCAAATTGAGGCCGTGTTTAGTTCTAAAATAATTCTTCAAACTTTCAACTTTTCCATCACATCAAAACTTTCCTACACA[T/C]
ACAAACTTTCAACTTTTCCGTCACATCGTTCCAATTTCAACCAAATTTTCAATTTTGGTGTGAACTAAACACAGCCTGAATGGGCAACTGGACTGTGCAT

Reverse complement sequence

ATGCACAGTCCAGTTGCCCATTCAGGCTGTGTTTAGTTCACACCAAAATTGAAAATTTGGTTGAAATTGGAACGATGTGACGGAAAAGTTGAAAGTTTGT[A/G]
TGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTGAAAGTTTGAAGAATTATTTTAGAACTAAACACGGCCTCAATTTGGCAGCCAACTCCCATCGCCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	46.40%	0.06%	0.51%	NA
All Indica	2759	89.00%	10.10%	0.07%	0.80%	NA
All Japonica	1512	0.30%	99.70%	0.00%	0.07%	NA
Aus	269	7.40%	92.60%	0.00%	0.00%	NA
Indica I	595	98.20%	1.30%	0.17%	0.34%	NA
Indica II	465	91.60%	7.70%	0.00%	0.65%	NA
Indica III	913	86.20%	13.10%	0.00%	0.66%	NA
Indica Intermediate	786	83.70%	14.80%	0.13%	1.40%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	31.10%	66.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228484792	T -> DEL	N	N	silent_mutation	Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0228484792	T -> C	LOC_Os02g46660.1	upstream_gene_variant ; 3436.0bp to feature; MODIFIER	silent_mutation	Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0228484792	T -> C	LOC_Os02g46670.1	upstream_gene_variant ; 655.0bp to feature; MODIFIER	silent_mutation	Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0228484792	T -> C	LOC_Os02g46680.1	downstream_gene_variant ; 2757.0bp to feature; MODIFIER	silent_mutation	Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0228484792	T -> C	LOC_Os02g46670-LOC_Os02g46680	intergenic_region ; MODIFIER	silent_mutation	Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228484792	NA	3.34E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	9.14E-50	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	2.23E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	7.48E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	2.67E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	1.12E-12	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	5.39E-43	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	5.39E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	3.67E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	3.59E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	1.23E-27	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	1.54E-51	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	3.56E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	2.34E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	3.27E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	1.43E-16	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	2.96E-07	2.96E-07	mr1335_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	6.40E-14	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	7.20E-21	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	2.05E-31	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	4.62E-31	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	2.05E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	1.15E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	6.36E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792	NA	1.13E-30	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251