\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228484792:

Variant ID: vg0228484792 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28484792
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGGCGATGGGAGTTGGCTGCCAAATTGAGGCCGTGTTTAGTTCTAAAATAATTCTTCAAACTTTCAACTTTTCCATCACATCAAAACTTTCCTACACA[T/C]
ACAAACTTTCAACTTTTCCGTCACATCGTTCCAATTTCAACCAAATTTTCAATTTTGGTGTGAACTAAACACAGCCTGAATGGGCAACTGGACTGTGCAT

Reverse complement sequence

ATGCACAGTCCAGTTGCCCATTCAGGCTGTGTTTAGTTCACACCAAAATTGAAAATTTGGTTGAAATTGGAACGATGTGACGGAAAAGTTGAAAGTTTGT[A/G]
TGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTGAAAGTTTGAAGAATTATTTTAGAACTAAACACGGCCTCAATTTGGCAGCCAACTCCCATCGCCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 46.40% 0.06% 0.51% NA
All Indica  2759 89.00% 10.10% 0.07% 0.80% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.07% NA
Aus  269 7.40% 92.60% 0.00% 0.00% NA
Indica I  595 98.20% 1.30% 0.17% 0.34% NA
Indica II  465 91.60% 7.70% 0.00% 0.65% NA
Indica III  913 86.20% 13.10% 0.00% 0.66% NA
Indica Intermediate  786 83.70% 14.80% 0.13% 1.40% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 31.10% 66.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228484792 T -> DEL N N silent_mutation Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006 N N N N
vg0228484792 T -> C LOC_Os02g46660.1 upstream_gene_variant ; 3436.0bp to feature; MODIFIER silent_mutation Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006 N N N N
vg0228484792 T -> C LOC_Os02g46670.1 upstream_gene_variant ; 655.0bp to feature; MODIFIER silent_mutation Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006 N N N N
vg0228484792 T -> C LOC_Os02g46680.1 downstream_gene_variant ; 2757.0bp to feature; MODIFIER silent_mutation Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006 N N N N
vg0228484792 T -> C LOC_Os02g46670-LOC_Os02g46680 intergenic_region ; MODIFIER silent_mutation Average:60.384; most accessible tissue: Zhenshan97 flower, score: 80.006 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228484792 NA 3.34E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 9.14E-50 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 2.23E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 7.48E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 2.67E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 1.12E-12 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 5.39E-43 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 5.39E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 3.67E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 3.59E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 1.23E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 1.54E-51 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 3.56E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 2.34E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 3.27E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 1.43E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 2.96E-07 2.96E-07 mr1335_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 6.40E-14 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 7.20E-21 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 2.05E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 4.62E-31 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 2.05E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 1.15E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 6.36E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228484792 NA 1.13E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251