\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228241702:

Variant ID: vg0228241702 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28241702
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGCCAATTTTGTTTCAATTCCCTCCTTCTCTCTTTGTCCCCACACACTCTCCGTCACTGCACCCAGATTGAGTACATGTTGCGATCATCATTGTCGTC[G/A]
TTAGGGTCACCATTCGCTCTGGCCACACCATCGTCGCCTTCATCGTCTAGAGTTCCGCCATTCACTGCGGACGTCTCCGTTGTCGTCTCGAGTCCCTCCG

Reverse complement sequence

CGGAGGGACTCGAGACGACAACGGAGACGTCCGCAGTGAATGGCGGAACTCTAGACGATGAAGGCGACGATGGTGTGGCCAGAGCGAATGGTGACCCTAA[C/T]
GACGACAATGATGATCGCAACATGTACTCAATCTGGGTGCAGTGACGGAGAGTGTGTGGGGACAAAGAGAGAAGGAGGGAATTGAAACAAAATTGGCGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 2.50% 1.42% 0.00% NA
All Indica  2759 93.40% 4.20% 2.43% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 0.00% 4.20% 0.00% NA
Indica II  465 77.00% 17.60% 5.38% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 4.20% 2.16% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228241702 G -> A LOC_Os02g46340.1 upstream_gene_variant ; 4707.0bp to feature; MODIFIER silent_mutation Average:74.117; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0228241702 G -> A LOC_Os02g46320.1 downstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:74.117; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0228241702 G -> A LOC_Os02g46320-LOC_Os02g46340 intergenic_region ; MODIFIER silent_mutation Average:74.117; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228241702 NA 1.04E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 NA 6.43E-06 mr1020_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 8.95E-07 8.94E-07 mr1313_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 7.23E-06 7.23E-06 mr1313_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 NA 6.91E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 NA 9.21E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 2.39E-08 2.38E-08 mr1473_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 5.96E-07 5.96E-07 mr1473_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 NA 1.15E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 3.32E-08 3.31E-08 mr1630_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 7.20E-07 7.20E-07 mr1630_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 1.20E-08 1.20E-08 mr1848_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 1.36E-07 1.36E-07 mr1848_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 NA 9.47E-07 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228241702 NA 5.05E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251