\
| Variant ID: vg0228217298 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28217298 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )
TCCTCTACGGCCCGTCTAATGTCTCTTCTCTTTATTGTCATTGAGATTTTAAAAATCGAACATAATTATTGTCTGGGTTCAATTTTACTTTCAAGAAGTC[T/C]
CGCCAAAATGTCTATGGCTTTGCCATTGTACTCCTCTATAGCTCGCCCGCAGCATTCCTTCTTTATTGTCATTGAGATTTTAAAATCGAACATGATTATT
AATAATCATGTTCGATTTTAAAATCTCAATGACAATAAAGAAGGAATGCTGCGGGCGAGCTATAGAGGAGTACAATGGCAAAGCCATAGACATTTTGGCG[A/G]
GACTTCTTGAAAGTAAAATTGAACCCAGACAATAATTATGTTCGATTTTTAAAATCTCAATGACAATAAAGAGAAGAGACATTAGACGGGCCGTAGAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.60% | 16.30% | 16.04% | 42.11% | NA |
| All Indica | 2759 | 7.80% | 1.20% | 22.69% | 68.36% | NA |
| All Japonica | 1512 | 48.90% | 47.00% | 3.64% | 0.46% | NA |
| Aus | 269 | 48.00% | 0.40% | 23.42% | 28.25% | NA |
| Indica I | 595 | 4.00% | 0.50% | 19.33% | 76.13% | NA |
| Indica II | 465 | 5.40% | 1.70% | 17.20% | 75.70% | NA |
| Indica III | 913 | 11.00% | 0.10% | 30.67% | 58.27% | NA |
| Indica Intermediate | 786 | 8.40% | 2.50% | 19.21% | 69.85% | NA |
| Temperate Japonica | 767 | 17.60% | 77.60% | 4.43% | 0.39% | NA |
| Tropical Japonica | 504 | 92.90% | 4.60% | 1.98% | 0.60% | NA |
| Japonica Intermediate | 241 | 56.40% | 38.60% | 4.56% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 41.10% | 21.10% | 15.56% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228217298 | T -> DEL | N | N | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46260.1 | downstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46270.1 | downstream_gene_variant ; 3279.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46275.1 | downstream_gene_variant ; 4960.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46260.2 | downstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46260.3 | downstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46260.5 | downstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46260.6 | downstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46260.4 | downstream_gene_variant ; 355.0bp to feature; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0228217298 | T -> C | LOC_Os02g46260-LOC_Os02g46270 | intergenic_region ; MODIFIER | silent_mutation | Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228217298 | NA | 2.42E-09 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 4.38E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 2.83E-08 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 1.12E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 4.46E-08 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 7.88E-08 | mr1606 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 9.22E-07 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 1.22E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228217298 | NA | 7.24E-10 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |