\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228217298:

Variant ID: vg0228217298 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28217298
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCTACGGCCCGTCTAATGTCTCTTCTCTTTATTGTCATTGAGATTTTAAAAATCGAACATAATTATTGTCTGGGTTCAATTTTACTTTCAAGAAGTC[T/C]
CGCCAAAATGTCTATGGCTTTGCCATTGTACTCCTCTATAGCTCGCCCGCAGCATTCCTTCTTTATTGTCATTGAGATTTTAAAATCGAACATGATTATT

Reverse complement sequence

AATAATCATGTTCGATTTTAAAATCTCAATGACAATAAAGAAGGAATGCTGCGGGCGAGCTATAGAGGAGTACAATGGCAAAGCCATAGACATTTTGGCG[A/G]
GACTTCTTGAAAGTAAAATTGAACCCAGACAATAATTATGTTCGATTTTTAAAATCTCAATGACAATAAAGAGAAGAGACATTAGACGGGCCGTAGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.60% 16.30% 16.04% 42.11% NA
All Indica  2759 7.80% 1.20% 22.69% 68.36% NA
All Japonica  1512 48.90% 47.00% 3.64% 0.46% NA
Aus  269 48.00% 0.40% 23.42% 28.25% NA
Indica I  595 4.00% 0.50% 19.33% 76.13% NA
Indica II  465 5.40% 1.70% 17.20% 75.70% NA
Indica III  913 11.00% 0.10% 30.67% 58.27% NA
Indica Intermediate  786 8.40% 2.50% 19.21% 69.85% NA
Temperate Japonica  767 17.60% 77.60% 4.43% 0.39% NA
Tropical Japonica  504 92.90% 4.60% 1.98% 0.60% NA
Japonica Intermediate  241 56.40% 38.60% 4.56% 0.41% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 41.10% 21.10% 15.56% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228217298 T -> DEL N N silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46260.1 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46270.1 downstream_gene_variant ; 3279.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46275.1 downstream_gene_variant ; 4960.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46260.2 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46260.3 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46260.5 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46260.6 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46260.4 downstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0228217298 T -> C LOC_Os02g46260-LOC_Os02g46270 intergenic_region ; MODIFIER silent_mutation Average:23.466; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228217298 NA 2.42E-09 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 4.38E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 2.83E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 1.12E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 4.46E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 7.88E-08 mr1606 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 9.22E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 1.22E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228217298 NA 7.24E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251