Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228211507:

Variant ID: vg0228211507 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28211507
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCTTTGGCTGGCGTCCTCTGGCTTCATAGACTATGGTGGGTGTGCTGGCGCTATGATTCGATGATCATGAACTCCTCAAGGGGTATGCCTTTTATACT[G/A]
TGAATTGCCTTAGTCTTCAAGTAGAACCCGGAGACAACAAACCCTCCACGATATAGAATTATCCCTATCTTTTCCGAGTAGGATTCTGATAGTTACTAGC

Reverse complement sequence

GCTAGTAACTATCAGAATCCTACTCGGAAAAGATAGGGATAATTCTATATCGTGGAGGGTTTGTTGTCTCCGGGTTCTACTTGAAGACTAAGGCAATTCA[C/T]
AGTATAAAAGGCATACCCCTTGAGGAGTTCATGATCATCGAATCATAGCGCCAGCACACCCACCATAGTCTATGAAGCCAGAGGACGCCAGCCAAAGCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	45.60%	0.59%	0.06%	NA
All Indica	2759	23.30%	75.90%	0.80%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.20%	0.07%	NA
Aus	269	87.00%	12.30%	0.37%	0.37%	NA
Indica I	595	10.30%	88.20%	1.51%	0.00%	NA
Indica II	465	24.30%	75.10%	0.65%	0.00%	NA
Indica III	913	27.80%	72.10%	0.11%	0.00%	NA
Indica Intermediate	786	27.40%	71.50%	1.15%	0.00%	NA
Temperate Japonica	767	99.30%	0.30%	0.26%	0.13%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	24.40%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228211507	G -> A	LOC_Os02g46260.1	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N
vg0228211507	G -> A	LOC_Os02g46260.2	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N
vg0228211507	G -> A	LOC_Os02g46260.3	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N
vg0228211507	G -> A	LOC_Os02g46260.5	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N
vg0228211507	G -> A	LOC_Os02g46260.6	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N
vg0228211507	G -> A	LOC_Os02g46260.4	upstream_gene_variant ; 656.0bp to feature; MODIFIER	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N
vg0228211507	G -> A	LOC_Os02g46250-LOC_Os02g46260	intergenic_region ; MODIFIER	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N
vg0228211507	G -> DEL	N	N	silent_mutation	Average:38.245; most accessible tissue: Callus, score: 53.924	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228211507	4.02E-06	1.74E-09	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	2.70E-08	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	3.83E-06	2.51E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	4.19E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	1.61E-06	1.45E-09	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	4.42E-06	1.80E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	6.26E-10	mr1220	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	1.68E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	2.18E-15	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	3.52E-06	3.00E-08	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	5.65E-06	4.89E-10	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	6.71E-12	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	3.96E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	3.22E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	2.99E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	2.89E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	2.60E-07	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	7.64E-06	NA	mr1103_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	7.21E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	7.38E-13	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	2.79E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	1.63E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507	NA	8.36E-06	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251