\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228211507:

Variant ID: vg0228211507 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28211507
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCTTTGGCTGGCGTCCTCTGGCTTCATAGACTATGGTGGGTGTGCTGGCGCTATGATTCGATGATCATGAACTCCTCAAGGGGTATGCCTTTTATACT[G/A]
TGAATTGCCTTAGTCTTCAAGTAGAACCCGGAGACAACAAACCCTCCACGATATAGAATTATCCCTATCTTTTCCGAGTAGGATTCTGATAGTTACTAGC

Reverse complement sequence

GCTAGTAACTATCAGAATCCTACTCGGAAAAGATAGGGATAATTCTATATCGTGGAGGGTTTGTTGTCTCCGGGTTCTACTTGAAGACTAAGGCAATTCA[C/T]
AGTATAAAAGGCATACCCCTTGAGGAGTTCATGATCATCGAATCATAGCGCCAGCACACCCACCATAGTCTATGAAGCCAGAGGACGCCAGCCAAAGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 45.60% 0.59% 0.06% NA
All Indica  2759 23.30% 75.90% 0.80% 0.00% NA
All Japonica  1512 99.50% 0.30% 0.20% 0.07% NA
Aus  269 87.00% 12.30% 0.37% 0.37% NA
Indica I  595 10.30% 88.20% 1.51% 0.00% NA
Indica II  465 24.30% 75.10% 0.65% 0.00% NA
Indica III  913 27.80% 72.10% 0.11% 0.00% NA
Indica Intermediate  786 27.40% 71.50% 1.15% 0.00% NA
Temperate Japonica  767 99.30% 0.30% 0.26% 0.13% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 24.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228211507 G -> A LOC_Os02g46260.1 upstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211507 G -> A LOC_Os02g46260.2 upstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211507 G -> A LOC_Os02g46260.3 upstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211507 G -> A LOC_Os02g46260.5 upstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211507 G -> A LOC_Os02g46260.6 upstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211507 G -> A LOC_Os02g46260.4 upstream_gene_variant ; 656.0bp to feature; MODIFIER silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211507 G -> A LOC_Os02g46250-LOC_Os02g46260 intergenic_region ; MODIFIER silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211507 G -> DEL N N silent_mutation Average:38.245; most accessible tissue: Callus, score: 53.924 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228211507 4.02E-06 1.74E-09 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 2.70E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 3.83E-06 2.51E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 4.19E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 1.61E-06 1.45E-09 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 4.42E-06 1.80E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 6.26E-10 mr1220 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 1.68E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 2.18E-15 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 3.52E-06 3.00E-08 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 5.65E-06 4.89E-10 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 6.71E-12 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 3.96E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 3.22E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 2.99E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 2.89E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 2.60E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 7.64E-06 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 7.21E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 7.38E-13 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 2.79E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 1.63E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211507 NA 8.36E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251