\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228211458:

Variant ID: vg0228211458 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28211458
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GACAATACCGGCGAGATCCTTGTCGAGATGATTCAACGAGATCTCCCGACGGCTTTGGCTGGCGTCCTCTGGCTTCATAGACTATGGTGGGTGTGCTGGC[G/A]
CTATGATTCGATGATCATGAACTCCTCAAGGGGTATGCCTTTTATACTGTGAATTGCCTTAGTCTTCAAGTAGAACCCGGAGACAACAAACCCTCCACGA

Reverse complement sequence

TCGTGGAGGGTTTGTTGTCTCCGGGTTCTACTTGAAGACTAAGGCAATTCACAGTATAAAAGGCATACCCCTTGAGGAGTTCATGATCATCGAATCATAG[C/T]
GCCAGCACACCCACCATAGTCTATGAAGCCAGAGGACGCCAGCCAAAGCCGTCGGGAGATCTCGTTGAATCATCTCGACAAGGATCTCGCCGGTATTGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 45.70% 0.59% 0.04% NA
All Indica  2759 23.20% 76.00% 0.80% 0.00% NA
All Japonica  1512 99.50% 0.30% 0.20% 0.07% NA
Aus  269 87.00% 12.60% 0.37% 0.00% NA
Indica I  595 10.10% 88.40% 1.51% 0.00% NA
Indica II  465 23.90% 75.50% 0.65% 0.00% NA
Indica III  913 27.80% 72.10% 0.11% 0.00% NA
Indica Intermediate  786 27.20% 71.60% 1.15% 0.00% NA
Temperate Japonica  767 99.30% 0.30% 0.26% 0.13% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 23.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228211458 G -> A LOC_Os02g46260.1 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211458 G -> A LOC_Os02g46260.2 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211458 G -> A LOC_Os02g46260.3 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211458 G -> A LOC_Os02g46260.5 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211458 G -> A LOC_Os02g46260.6 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211458 G -> A LOC_Os02g46260.4 upstream_gene_variant ; 705.0bp to feature; MODIFIER silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211458 G -> A LOC_Os02g46250-LOC_Os02g46260 intergenic_region ; MODIFIER silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N
vg0228211458 G -> DEL N N silent_mutation Average:39.737; most accessible tissue: Callus, score: 53.924 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228211458 NA 5.08E-31 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 2.52E-06 1.05E-09 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 6.80E-06 3.19E-57 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 9.81E-09 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 4.51E-07 2.58E-09 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 1.38E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 5.46E-07 2.42E-10 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 3.17E-20 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 1.76E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 1.38E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 9.81E-07 4.38E-09 mr1213 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 2.08E-09 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 7.06E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 5.80E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 7.54E-16 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 5.16E-06 5.65E-08 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 3.29E-20 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 1.84E-06 1.23E-10 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 4.69E-06 8.21E-13 mr1342 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 1.47E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 2.71E-06 4.08E-08 mr1560 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 1.42E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 6.85E-13 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 1.27E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 1.30E-06 NA mr1103_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 1.98E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 7.20E-13 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 8.57E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 7.80E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 7.84E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211458 NA 4.30E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251