\
| Variant ID: vg0228211407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28211407 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )
ATATGGGATTGATATGGAAAACCATAGAATACAAAGAGAACAGATGGATCCGACAATACCGGCGAGATCCTTGTCGAGATGATTCAACGAGATCTCCCGA[C/T]
GGCTTTGGCTGGCGTCCTCTGGCTTCATAGACTATGGTGGGTGTGCTGGCGCTATGATTCGATGATCATGAACTCCTCAAGGGGTATGCCTTTTATACTG
CAGTATAAAAGGCATACCCCTTGAGGAGTTCATGATCATCGAATCATAGCGCCAGCACACCCACCATAGTCTATGAAGCCAGAGGACGCCAGCCAAAGCC[G/A]
TCGGGAGATCTCGTTGAATCATCTCGACAAGGATCTCGCCGGTATTGTCGGATCCATCTGTTCTCTTTGTATTCTATGGTTTTCCATATCAATCCCATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.80% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 91.70% | 8.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.10% | 5.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.30% | 10.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228211407 | C -> T | LOC_Os02g46260.1 | upstream_gene_variant ; 659.0bp to feature; MODIFIER | silent_mutation | Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| vg0228211407 | C -> T | LOC_Os02g46260.2 | upstream_gene_variant ; 659.0bp to feature; MODIFIER | silent_mutation | Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| vg0228211407 | C -> T | LOC_Os02g46260.3 | upstream_gene_variant ; 659.0bp to feature; MODIFIER | silent_mutation | Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| vg0228211407 | C -> T | LOC_Os02g46260.5 | upstream_gene_variant ; 659.0bp to feature; MODIFIER | silent_mutation | Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| vg0228211407 | C -> T | LOC_Os02g46260.6 | upstream_gene_variant ; 659.0bp to feature; MODIFIER | silent_mutation | Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| vg0228211407 | C -> T | LOC_Os02g46260.4 | upstream_gene_variant ; 756.0bp to feature; MODIFIER | silent_mutation | Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| vg0228211407 | C -> T | LOC_Os02g46250-LOC_Os02g46260 | intergenic_region ; MODIFIER | silent_mutation | Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228211407 | 2.48E-06 | NA | mr1088 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 2.40E-07 | 4.34E-07 | mr1088 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 2.92E-06 | NA | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 2.93E-06 | NA | mr1139 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 6.37E-06 | NA | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 1.40E-06 | 2.55E-06 | mr1225 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 7.08E-06 | NA | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 9.32E-07 | 6.31E-07 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 5.87E-06 | NA | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 5.08E-06 | NA | mr1264 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 2.51E-06 | 6.83E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | 1.66E-06 | NA | mr1620 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211407 | NA | 4.60E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |