\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228211407:

Variant ID: vg0228211407 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28211407
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGGGATTGATATGGAAAACCATAGAATACAAAGAGAACAGATGGATCCGACAATACCGGCGAGATCCTTGTCGAGATGATTCAACGAGATCTCCCGA[C/T]
GGCTTTGGCTGGCGTCCTCTGGCTTCATAGACTATGGTGGGTGTGCTGGCGCTATGATTCGATGATCATGAACTCCTCAAGGGGTATGCCTTTTATACTG

Reverse complement sequence

CAGTATAAAAGGCATACCCCTTGAGGAGTTCATGATCATCGAATCATAGCGCCAGCACACCCACCATAGTCTATGAAGCCAGAGGACGCCAGCCAAAGCC[G/A]
TCGGGAGATCTCGTTGAATCATCTCGACAAGGATCTCGCCGGTATTGTCGGATCCATCTGTTCTCTTTGTATTCTATGGTTTTCCATATCAATCCCATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.80% 0.08% 0.00% NA
All Indica  2759 91.70% 8.20% 0.14% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.10% 5.50% 0.34% 0.00% NA
Indica II  465 86.70% 13.30% 0.00% 0.00% NA
Indica III  913 94.70% 5.30% 0.00% 0.00% NA
Indica Intermediate  786 89.30% 10.40% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228211407 C -> T LOC_Os02g46260.1 upstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0228211407 C -> T LOC_Os02g46260.2 upstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0228211407 C -> T LOC_Os02g46260.3 upstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0228211407 C -> T LOC_Os02g46260.5 upstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0228211407 C -> T LOC_Os02g46260.6 upstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0228211407 C -> T LOC_Os02g46260.4 upstream_gene_variant ; 756.0bp to feature; MODIFIER silent_mutation Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg0228211407 C -> T LOC_Os02g46250-LOC_Os02g46260 intergenic_region ; MODIFIER silent_mutation Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228211407 2.48E-06 NA mr1088 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 2.40E-07 4.34E-07 mr1088 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 2.92E-06 NA mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 2.93E-06 NA mr1139 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 6.37E-06 NA mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 1.40E-06 2.55E-06 mr1225 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 7.08E-06 NA mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 9.32E-07 6.31E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 5.87E-06 NA mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 5.08E-06 NA mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 2.51E-06 6.83E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 1.66E-06 NA mr1620 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407 NA 4.60E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251