Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228211407:

Variant ID: vg0228211407 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28211407
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ATATGGGATTGATATGGAAAACCATAGAATACAAAGAGAACAGATGGATCCGACAATACCGGCGAGATCCTTGTCGAGATGATTCAACGAGATCTCCCGA[C/T]
GGCTTTGGCTGGCGTCCTCTGGCTTCATAGACTATGGTGGGTGTGCTGGCGCTATGATTCGATGATCATGAACTCCTCAAGGGGTATGCCTTTTATACTG

Reverse complement sequence

CAGTATAAAAGGCATACCCCTTGAGGAGTTCATGATCATCGAATCATAGCGCCAGCACACCCACCATAGTCTATGAAGCCAGAGGACGCCAGCCAAAGCC[G/A]
TCGGGAGATCTCGTTGAATCATCTCGACAAGGATCTCGCCGGTATTGTCGGATCCATCTGTTCTCTTTGTATTCTATGGTTTTCCATATCAATCCCATAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.10%	4.80%	0.08%	0.00%	NA
All Indica	2759	91.70%	8.20%	0.14%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.10%	5.50%	0.34%	0.00%	NA
Indica II	465	86.70%	13.30%	0.00%	0.00%	NA
Indica III	913	94.70%	5.30%	0.00%	0.00%	NA
Indica Intermediate	786	89.30%	10.40%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228211407	C -> T	LOC_Os02g46260.1	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0228211407	C -> T	LOC_Os02g46260.2	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0228211407	C -> T	LOC_Os02g46260.3	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0228211407	C -> T	LOC_Os02g46260.5	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0228211407	C -> T	LOC_Os02g46260.6	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0228211407	C -> T	LOC_Os02g46260.4	upstream_gene_variant ; 756.0bp to feature; MODIFIER	silent_mutation	Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0228211407	C -> T	LOC_Os02g46250-LOC_Os02g46260	intergenic_region ; MODIFIER	silent_mutation	Average:39.642; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228211407	2.48E-06	NA	mr1088	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	2.40E-07	4.34E-07	mr1088	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	2.92E-06	NA	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	2.93E-06	NA	mr1139	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	6.37E-06	NA	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	1.40E-06	2.55E-06	mr1225	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	7.08E-06	NA	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	9.32E-07	6.31E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	5.87E-06	NA	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	5.08E-06	NA	mr1264	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	2.51E-06	6.83E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	1.66E-06	NA	mr1620	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211407	NA	4.60E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251