Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228211068:

Variant ID: vg0228211068 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28211068
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CATAGATGTGAGGATGAAAGAAAGAGATGAAGGGGGATGAACAGAGCAATTGCAATCTTCTACCCTCTTGCTTTTCCCATGCCTCTTGCTGTTTGTGGCT[G/A]
CAATGGTGAGTACTGAATCTGGTGTTGACAGTCCTTAAATCATAATATCTAACCGCCAATATCTGCATATAATGAAATAAAATATGGTATCTGTCGACGG

Reverse complement sequence

CCGTCGACAGATACCATATTTTATTTCATTATATGCAGATATTGGCGGTTAGATATTATGATTTAAGGACTGTCAACACCAGATTCAGTACTCACCATTG[C/T]
AGCCACAAACAGCAAGAGGCATGGGAAAAGCAAGAGGGTAGAAGATTGCAATTGCTCTGTTCATCCCCCTTCATCTCTTTCTTTCATCCTCACATCTATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.70%	0.06%	0.00%	NA
All Indica	2759	91.90%	8.00%	0.07%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.50%	5.40%	0.17%	0.00%	NA
Indica II	465	86.70%	13.30%	0.00%	0.00%	NA
Indica III	913	94.90%	5.10%	0.00%	0.00%	NA
Indica Intermediate	786	89.60%	10.30%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228211068	G -> A	LOC_Os02g46260.1	upstream_gene_variant ; 998.0bp to feature; MODIFIER	silent_mutation	Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0228211068	G -> A	LOC_Os02g46260.2	upstream_gene_variant ; 998.0bp to feature; MODIFIER	silent_mutation	Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0228211068	G -> A	LOC_Os02g46260.3	upstream_gene_variant ; 998.0bp to feature; MODIFIER	silent_mutation	Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0228211068	G -> A	LOC_Os02g46260.5	upstream_gene_variant ; 998.0bp to feature; MODIFIER	silent_mutation	Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0228211068	G -> A	LOC_Os02g46260.6	upstream_gene_variant ; 998.0bp to feature; MODIFIER	silent_mutation	Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0228211068	G -> A	LOC_Os02g46260.4	upstream_gene_variant ; 1095.0bp to feature; MODIFIER	silent_mutation	Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N
vg0228211068	G -> A	LOC_Os02g46250-LOC_Os02g46260	intergenic_region ; MODIFIER	silent_mutation	Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228211068	9.42E-07	2.24E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	2.88E-06	NA	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	4.21E-06	NA	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	1.91E-06	6.77E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	3.37E-06	NA	mr1246	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	7.99E-07	1.19E-06	mr1246	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	7.62E-06	NA	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	2.25E-06	9.06E-06	mr1404	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068	4.59E-06	NA	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251