\
| Variant ID: vg0228211068 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28211068 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
CATAGATGTGAGGATGAAAGAAAGAGATGAAGGGGGATGAACAGAGCAATTGCAATCTTCTACCCTCTTGCTTTTCCCATGCCTCTTGCTGTTTGTGGCT[G/A]
CAATGGTGAGTACTGAATCTGGTGTTGACAGTCCTTAAATCATAATATCTAACCGCCAATATCTGCATATAATGAAATAAAATATGGTATCTGTCGACGG
CCGTCGACAGATACCATATTTTATTTCATTATATGCAGATATTGGCGGTTAGATATTATGATTTAAGGACTGTCAACACCAGATTCAGTACTCACCATTG[C/T]
AGCCACAAACAGCAAGAGGCATGGGAAAAGCAAGAGGGTAGAAGATTGCAATTGCTCTGTTCATCCCCCTTCATCTCTTTCTTTCATCCTCACATCTATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 4.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 91.90% | 8.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.60% | 10.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228211068 | G -> A | LOC_Os02g46260.1 | upstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0228211068 | G -> A | LOC_Os02g46260.2 | upstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0228211068 | G -> A | LOC_Os02g46260.3 | upstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0228211068 | G -> A | LOC_Os02g46260.5 | upstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0228211068 | G -> A | LOC_Os02g46260.6 | upstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0228211068 | G -> A | LOC_Os02g46260.4 | upstream_gene_variant ; 1095.0bp to feature; MODIFIER | silent_mutation | Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0228211068 | G -> A | LOC_Os02g46250-LOC_Os02g46260 | intergenic_region ; MODIFIER | silent_mutation | Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228211068 | 9.42E-07 | 2.24E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 2.88E-06 | NA | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 4.21E-06 | NA | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 1.91E-06 | 6.77E-06 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 3.37E-06 | NA | mr1246 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 7.99E-07 | 1.19E-06 | mr1246 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 7.62E-06 | NA | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 2.25E-06 | 9.06E-06 | mr1404 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228211068 | 4.59E-06 | NA | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |