\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228211068:

Variant ID: vg0228211068 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28211068
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CATAGATGTGAGGATGAAAGAAAGAGATGAAGGGGGATGAACAGAGCAATTGCAATCTTCTACCCTCTTGCTTTTCCCATGCCTCTTGCTGTTTGTGGCT[G/A]
CAATGGTGAGTACTGAATCTGGTGTTGACAGTCCTTAAATCATAATATCTAACCGCCAATATCTGCATATAATGAAATAAAATATGGTATCTGTCGACGG

Reverse complement sequence

CCGTCGACAGATACCATATTTTATTTCATTATATGCAGATATTGGCGGTTAGATATTATGATTTAAGGACTGTCAACACCAGATTCAGTACTCACCATTG[C/T]
AGCCACAAACAGCAAGAGGCATGGGAAAAGCAAGAGGGTAGAAGATTGCAATTGCTCTGTTCATCCCCCTTCATCTCTTTCTTTCATCCTCACATCTATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.70% 0.06% 0.00% NA
All Indica  2759 91.90% 8.00% 0.07% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.17% 0.00% NA
Indica II  465 86.70% 13.30% 0.00% 0.00% NA
Indica III  913 94.90% 5.10% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 10.30% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228211068 G -> A LOC_Os02g46260.1 upstream_gene_variant ; 998.0bp to feature; MODIFIER silent_mutation Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0228211068 G -> A LOC_Os02g46260.2 upstream_gene_variant ; 998.0bp to feature; MODIFIER silent_mutation Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0228211068 G -> A LOC_Os02g46260.3 upstream_gene_variant ; 998.0bp to feature; MODIFIER silent_mutation Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0228211068 G -> A LOC_Os02g46260.5 upstream_gene_variant ; 998.0bp to feature; MODIFIER silent_mutation Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0228211068 G -> A LOC_Os02g46260.6 upstream_gene_variant ; 998.0bp to feature; MODIFIER silent_mutation Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0228211068 G -> A LOC_Os02g46260.4 upstream_gene_variant ; 1095.0bp to feature; MODIFIER silent_mutation Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0228211068 G -> A LOC_Os02g46250-LOC_Os02g46260 intergenic_region ; MODIFIER silent_mutation Average:33.821; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228211068 9.42E-07 2.24E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 2.88E-06 NA mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 4.21E-06 NA mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 1.91E-06 6.77E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 3.37E-06 NA mr1246 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 7.99E-07 1.19E-06 mr1246 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 7.62E-06 NA mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 2.25E-06 9.06E-06 mr1404 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228211068 4.59E-06 NA mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251