\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228210940:

Variant ID: vg0228210940 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28210940
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.04, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TGATCCCTCTTCGCCTCCTTTCACCAATCCGCGGCAATGGCACAATCGTTGTCATCTTCACGTGCTCTTCCTCCGTTGCAATTTGAGACAGAGAGGAATT[G/T]
CAATCCCTGACCTGGAGCTTTTTTGGCCATAGATGTGAGGATGAAAGAAAGAGATGAAGGGGGATGAACAGAGCAATTGCAATCTTCTACCCTCTTGCTT

Reverse complement sequence

AAGCAAGAGGGTAGAAGATTGCAATTGCTCTGTTCATCCCCCTTCATCTCTTTCTTTCATCCTCACATCTATGGCCAAAAAAGCTCCAGGTCAGGGATTG[C/A]
AATTCCTCTCTGTCTCAAATTGCAACGGAGGAAGAGCACGTGAAGATGACAACGATTGTGCCATTGCCGCGGATTGGTGAAAGGAGGCGAAGAGGGATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 45.60% 0.55% 0.00% NA
All Indica  2759 23.30% 75.90% 0.80% 0.00% NA
All Japonica  1512 99.50% 0.30% 0.13% 0.00% NA
Aus  269 87.40% 12.30% 0.37% 0.00% NA
Indica I  595 10.30% 88.20% 1.51% 0.00% NA
Indica II  465 23.90% 75.30% 0.86% 0.00% NA
Indica III  913 27.80% 72.10% 0.11% 0.00% NA
Indica Intermediate  786 27.50% 71.50% 1.02% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228210940 G -> T LOC_Os02g46260.1 upstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:38.255; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0228210940 G -> T LOC_Os02g46260.2 upstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:38.255; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0228210940 G -> T LOC_Os02g46260.3 upstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:38.255; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0228210940 G -> T LOC_Os02g46260.5 upstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:38.255; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0228210940 G -> T LOC_Os02g46260.6 upstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:38.255; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0228210940 G -> T LOC_Os02g46260.4 upstream_gene_variant ; 1223.0bp to feature; MODIFIER silent_mutation Average:38.255; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0228210940 G -> T LOC_Os02g46250-LOC_Os02g46260 intergenic_region ; MODIFIER silent_mutation Average:38.255; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228210940 NA 5.53E-31 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 2.37E-06 1.74E-09 mr1086 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 3.23E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 4.09E-07 5.21E-09 mr1103 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 2.40E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 4.18E-07 9.54E-10 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 6.60E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 3.08E-06 2.01E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 3.11E-09 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 3.92E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 1.85E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 6.92E-16 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 2.50E-06 3.30E-08 mr1233 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 1.83E-06 1.38E-10 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 9.16E-06 1.79E-12 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 5.64E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 7.81E-06 1.41E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 3.78E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 9.19E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 8.28E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 5.71E-13 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 6.90E-06 1.11E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 4.49E-06 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 8.07E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 5.48E-13 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 6.97E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 1.18E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228210940 NA 2.54E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251