\
| Variant ID: vg0228204274 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28204274 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCGCCCTAGGGCCAAGCCTGTGCTCTGATACCATCTCTTGTCACGCCCCGAACTAGTACCGACCGGAACTAGCCCGCGACGCTCCAAATTAACCTGTTA[G/A]
TTGATACCAGTCCCAAGAAACAGTGCTGGTATCACAGGAAGACAGATTATCACAGCAACAGAGGTCTCTTTATTATAGAGTAGAGGTACAGTCATGTTGG
CCAACATGACTGTACCTCTACTCTATAATAAAGAGACCTCTGTTGCTGTGATAATCTGTCTTCCTGTGATACCAGCACTGTTTCTTGGGACTGGTATCAA[C/T]
TAACAGGTTAATTTGGAGCGTCGCGGGCTAGTTCCGGTCGGTACTAGTTCGGGGCGTGACAAGAGATGGTATCAGAGCACAGGCTTGGCCCTAGGGCGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 2.30% | 18.03% | 41.66% | NA |
| All Indica | 2759 | 4.20% | 0.70% | 26.64% | 68.39% | NA |
| All Japonica | 1512 | 93.90% | 5.40% | 0.20% | 0.46% | NA |
| Aus | 269 | 41.30% | 0.40% | 39.41% | 18.96% | NA |
| Indica I | 595 | 3.70% | 0.20% | 3.87% | 92.27% | NA |
| Indica II | 465 | 4.50% | 1.90% | 44.73% | 48.82% | NA |
| Indica III | 913 | 2.50% | 0.70% | 36.04% | 60.79% | NA |
| Indica Intermediate | 786 | 6.50% | 0.50% | 22.26% | 70.74% | NA |
| Temperate Japonica | 767 | 97.80% | 1.80% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 85.70% | 13.10% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 2.20% | 7.78% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228204274 | G -> A | LOC_Os02g46240.1 | upstream_gene_variant ; 1872.0bp to feature; MODIFIER | silent_mutation | Average:10.156; most accessible tissue: Minghui63 root, score: 15.664 | N | N | N | N |
| vg0228204274 | G -> A | LOC_Os02g46250.1 | upstream_gene_variant ; 238.0bp to feature; MODIFIER | silent_mutation | Average:10.156; most accessible tissue: Minghui63 root, score: 15.664 | N | N | N | N |
| vg0228204274 | G -> A | LOC_Os02g46250-LOC_Os02g46260 | intergenic_region ; MODIFIER | silent_mutation | Average:10.156; most accessible tissue: Minghui63 root, score: 15.664 | N | N | N | N |
| vg0228204274 | G -> DEL | N | N | silent_mutation | Average:10.156; most accessible tissue: Minghui63 root, score: 15.664 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228204274 | NA | 4.82E-77 | mr1629 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228204274 | NA | 1.07E-10 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228204274 | NA | 2.02E-25 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228204274 | NA | 2.40E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228204274 | 1.44E-07 | 3.82E-21 | mr1342_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228204274 | 1.83E-12 | 7.91E-105 | mr1629_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228204274 | 7.89E-07 | NA | mr1789_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228204274 | 3.26E-07 | 1.72E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |