\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228145108:

Variant ID: vg0228145108 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 28145108
Reference Allele: TAAlternative Allele: TAA,AA,T,TAAAA,TAAA,TAAAAA
Primary Allele: AASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCACAATAATCCATAACCCCTGTTCTGAATGGCTTATGGACAACGGATTATTGCCGGTATGTTTTCTAAGCTTTTAAACGGTAAGATCTTCTTTTTTTT[TA/TAA,AA,T,TAAAA,TAAA,TAAAAA]
AAAAAAATCATCAGTTTCTTAGTAAACGTTTTTAATCAACTTATCAACTTAATTAATTTACAATATATACAGCTCATTAGTTTTTTCTTTTAGATAATTG

Reverse complement sequence

CAATTATCTAAAAGAAAAAACTAATGAGCTGTATATATTGTAAATTAATTAAGTTGATAAGTTGATTAAAAACGTTTACTAAGAAACTGATGATTTTTTT[TA/TTA,TT,A,TTTTA,TTTA,TTTTTA]
AAAAAAAAGAAGATCTTACCGTTTAAAAGCTTAGAAAACATACCGGCAATAATCCGTTGTCCATAAGCCATTCAGAACAGGGGTTATGGATTATTGTGGG

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 41.70% 8.40% 0.00% TAA: 1.35%; TAAAA: 0.32%; T: 0.04%; TAAAAA: 0.02%; TAAA: 0.02%
All Indica  2759 66.70% 25.00% 6.96% 0.00% TAA: 0.69%; TAAAA: 0.51%; T: 0.04%; TAAA: 0.04%
All Japonica  1512 23.70% 64.40% 11.31% 0.00% TAA: 0.60%
Aus  269 15.60% 77.30% 5.95% 0.00% T: 0.37%; TAAAAA: 0.37%; TAA: 0.37%
Indica I  595 70.80% 14.80% 13.95% 0.00% TAA: 0.34%; TAAAA: 0.17%
Indica II  465 45.20% 45.40% 9.46% 0.00% NA
Indica III  913 78.80% 17.20% 1.31% 0.00% TAAAA: 1.42%; TAA: 1.10%; T: 0.11%; TAAA: 0.11%
Indica Intermediate  786 62.50% 29.90% 6.74% 0.00% TAA: 0.89%
Temperate Japonica  767 19.00% 63.20% 16.95% 0.00% TAA: 0.78%
Tropical Japonica  504 31.50% 64.10% 4.17% 0.00% TAA: 0.20%
Japonica Intermediate  241 22.40% 68.50% 8.30% 0.00% TAA: 0.83%
VI/Aromatic  96 12.50% 51.00% 4.17% 0.00% TAA: 32.29%
Intermediate  90 25.60% 53.30% 15.56% 0.00% TAA: 4.44%; TAAAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228145108 TA -> TAA LOC_Os02g46190.1 upstream_gene_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAA LOC_Os02g46200.1 downstream_gene_variant ; 1844.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAA LOC_Os02g46190-LOC_Os02g46200 intergenic_region ; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAAA LOC_Os02g46190.1 upstream_gene_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAAA LOC_Os02g46200.1 downstream_gene_variant ; 1844.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAAA LOC_Os02g46190-LOC_Os02g46200 intergenic_region ; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAA LOC_Os02g46190.1 upstream_gene_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAA LOC_Os02g46200.1 downstream_gene_variant ; 1844.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAA LOC_Os02g46190-LOC_Os02g46200 intergenic_region ; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> AA LOC_Os02g46190.1 upstream_gene_variant ; 447.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> AA LOC_Os02g46200.1 downstream_gene_variant ; 1846.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> AA LOC_Os02g46190-LOC_Os02g46200 intergenic_region ; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> T LOC_Os02g46190.1 upstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> T LOC_Os02g46200.1 downstream_gene_variant ; 1845.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> T LOC_Os02g46190-LOC_Os02g46200 intergenic_region ; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAAAA LOC_Os02g46190.1 upstream_gene_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAAAA LOC_Os02g46200.1 downstream_gene_variant ; 1844.0bp to feature; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0228145108 TA -> TAAAAA LOC_Os02g46190-LOC_Os02g46200 intergenic_region ; MODIFIER silent_mutation Average:45.629; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228145108 2.16E-06 2.16E-06 mr1099 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228145108 NA 4.67E-06 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228145108 NA 4.29E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228145108 NA 4.12E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228145108 NA 1.01E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228145108 NA 1.93E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251