Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228034676:

Variant ID: vg0228034676 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28034676
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAGCCACAAACTAAGCCTTACCCACTAGACATGTGGAAGTACGGTAGTGCTTTGCAACATAGGCCCGAAGACCGGTCCTTATGTGGCCGAGGTGCTAC[A/T]
ATCAAAACCATGCACCCCGAGCCCAGCCTAAAACCATTTTGAGGATTTTGAATAGAGGGGGAGGTGTGAATCCAATTCCACAATAATCCAACCATTCCAT

Reverse complement sequence

ATGGAATGGTTGGATTATTGTGGAATTGGATTCACACCTCCCCCTCTATTCAAAATCCTCAAAATGGTTTTAGGCTGGGCTCGGGGTGCATGGTTTTGAT[T/A]
GTAGCACCTCGGCCACATAAGGACCGGTCTTCGGGCCTATGTTGCAAAGCACTACCGTACTTCCACATGTCTAGTGGGTAAGGCTTAGTTTGTGGCTCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 8.50% 8.70% 49.66% NA
All Indica  2759 7.00% 0.40% 9.31% 83.33% NA
All Japonica  1512 86.00% 13.40% 0.26% 0.33% NA
Aus  269 4.10% 37.20% 51.30% 7.43% NA
Indica I  595 4.90% 0.30% 2.86% 91.93% NA
Indica II  465 5.20% 0.20% 7.31% 87.31% NA
Indica III  913 9.20% 0.30% 12.38% 78.09% NA
Indica Intermediate  786 7.10% 0.50% 11.83% 80.53% NA
Temperate Japonica  767 99.50% 0.30% 0.00% 0.26% NA
Tropical Japonica  504 60.90% 37.90% 0.60% 0.60% NA
Japonica Intermediate  241 95.40% 4.10% 0.41% 0.00% NA
VI/Aromatic  96 20.80% 75.00% 3.12% 1.04% NA
Intermediate  90 46.70% 18.90% 10.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228034676 A -> T LOC_Os02g46000.1 upstream_gene_variant ; 4832.0bp to feature; MODIFIER silent_mutation Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0228034676 A -> T LOC_Os02g46010.1 upstream_gene_variant ; 1761.0bp to feature; MODIFIER silent_mutation Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0228034676 A -> T LOC_Os02g46020.1 upstream_gene_variant ; 922.0bp to feature; MODIFIER silent_mutation Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0228034676 A -> T LOC_Os02g46010-LOC_Os02g46020 intergenic_region ; MODIFIER silent_mutation Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0228034676 A -> DEL N N silent_mutation Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228034676 NA 1.89E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 1.17E-06 1.17E-06 mr1278 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 NA 1.92E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 NA 6.50E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 NA 4.46E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 NA 6.83E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 NA 1.19E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 NA 7.39E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676 NA 4.32E-17 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251