\
| Variant ID: vg0228034676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28034676 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 113. )
CTGAGCCACAAACTAAGCCTTACCCACTAGACATGTGGAAGTACGGTAGTGCTTTGCAACATAGGCCCGAAGACCGGTCCTTATGTGGCCGAGGTGCTAC[A/T]
ATCAAAACCATGCACCCCGAGCCCAGCCTAAAACCATTTTGAGGATTTTGAATAGAGGGGGAGGTGTGAATCCAATTCCACAATAATCCAACCATTCCAT
ATGGAATGGTTGGATTATTGTGGAATTGGATTCACACCTCCCCCTCTATTCAAAATCCTCAAAATGGTTTTAGGCTGGGCTCGGGGTGCATGGTTTTGAT[T/A]
GTAGCACCTCGGCCACATAAGGACCGGTCTTCGGGCCTATGTTGCAAAGCACTACCGTACTTCCACATGTCTAGTGGGTAAGGCTTAGTTTGTGGCTCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.10% | 8.50% | 8.70% | 49.66% | NA |
| All Indica | 2759 | 7.00% | 0.40% | 9.31% | 83.33% | NA |
| All Japonica | 1512 | 86.00% | 13.40% | 0.26% | 0.33% | NA |
| Aus | 269 | 4.10% | 37.20% | 51.30% | 7.43% | NA |
| Indica I | 595 | 4.90% | 0.30% | 2.86% | 91.93% | NA |
| Indica II | 465 | 5.20% | 0.20% | 7.31% | 87.31% | NA |
| Indica III | 913 | 9.20% | 0.30% | 12.38% | 78.09% | NA |
| Indica Intermediate | 786 | 7.10% | 0.50% | 11.83% | 80.53% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 60.90% | 37.90% | 0.60% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 75.00% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 46.70% | 18.90% | 10.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228034676 | A -> T | LOC_Os02g46000.1 | upstream_gene_variant ; 4832.0bp to feature; MODIFIER | silent_mutation | Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0228034676 | A -> T | LOC_Os02g46010.1 | upstream_gene_variant ; 1761.0bp to feature; MODIFIER | silent_mutation | Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0228034676 | A -> T | LOC_Os02g46020.1 | upstream_gene_variant ; 922.0bp to feature; MODIFIER | silent_mutation | Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0228034676 | A -> T | LOC_Os02g46010-LOC_Os02g46020 | intergenic_region ; MODIFIER | silent_mutation | Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0228034676 | A -> DEL | N | N | silent_mutation | Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228034676 | NA | 1.89E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | 1.17E-06 | 1.17E-06 | mr1278 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | NA | 1.92E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | NA | 6.50E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | NA | 4.46E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | NA | 6.83E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | NA | 1.19E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | NA | 7.39E-08 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228034676 | NA | 4.32E-17 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |