Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228034676:

Variant ID: vg0228034676 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28034676
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAGCCACAAACTAAGCCTTACCCACTAGACATGTGGAAGTACGGTAGTGCTTTGCAACATAGGCCCGAAGACCGGTCCTTATGTGGCCGAGGTGCTAC[A/T]
ATCAAAACCATGCACCCCGAGCCCAGCCTAAAACCATTTTGAGGATTTTGAATAGAGGGGGAGGTGTGAATCCAATTCCACAATAATCCAACCATTCCAT

Reverse complement sequence

ATGGAATGGTTGGATTATTGTGGAATTGGATTCACACCTCCCCCTCTATTCAAAATCCTCAAAATGGTTTTAGGCTGGGCTCGGGGTGCATGGTTTTGAT[T/A]
GTAGCACCTCGGCCACATAAGGACCGGTCTTCGGGCCTATGTTGCAAAGCACTACCGTACTTCCACATGTCTAGTGGGTAAGGCTTAGTTTGTGGCTCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.10%	8.50%	8.70%	49.66%	NA
All Indica	2759	7.00%	0.40%	9.31%	83.33%	NA
All Japonica	1512	86.00%	13.40%	0.26%	0.33%	NA
Aus	269	4.10%	37.20%	51.30%	7.43%	NA
Indica I	595	4.90%	0.30%	2.86%	91.93%	NA
Indica II	465	5.20%	0.20%	7.31%	87.31%	NA
Indica III	913	9.20%	0.30%	12.38%	78.09%	NA
Indica Intermediate	786	7.10%	0.50%	11.83%	80.53%	NA
Temperate Japonica	767	99.50%	0.30%	0.00%	0.26%	NA
Tropical Japonica	504	60.90%	37.90%	0.60%	0.60%	NA
Japonica Intermediate	241	95.40%	4.10%	0.41%	0.00%	NA
VI/Aromatic	96	20.80%	75.00%	3.12%	1.04%	NA
Intermediate	90	46.70%	18.90%	10.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228034676	A -> T	LOC_Os02g46000.1	upstream_gene_variant ; 4832.0bp to feature; MODIFIER	silent_mutation	Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0228034676	A -> T	LOC_Os02g46010.1	upstream_gene_variant ; 1761.0bp to feature; MODIFIER	silent_mutation	Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0228034676	A -> T	LOC_Os02g46020.1	upstream_gene_variant ; 922.0bp to feature; MODIFIER	silent_mutation	Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0228034676	A -> T	LOC_Os02g46010-LOC_Os02g46020	intergenic_region ; MODIFIER	silent_mutation	Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0228034676	A -> DEL	N	N	silent_mutation	Average:26.98; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228034676	NA	1.89E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	1.17E-06	1.17E-06	mr1278	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	NA	1.92E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	NA	6.50E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	NA	4.46E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	NA	6.83E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	NA	1.19E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	NA	7.39E-08	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228034676	NA	4.32E-17	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251