\
| Variant ID: vg0228028944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28028944 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 222. )
ACAATGACAGTGCTAACGGAGTGTGGCGTGGCGGCAATATAGAGGAATAATTCTTCATTAGGTTGGGGAGCAACAAGTACAGGGGGGTTTGATAGGTAGC[A/G]
CTTGAGTGCAATGAATGCCTCTTCGGCTTCCTATGTCCATACAAATTTGTCTTGTTTCTTCAACAGAGCGAAGAAAGGTTGTCCTCGTTCTCCCATCCTA
TAGGATGGGAGAACGAGGACAACCTTTCTTCGCTCTGTTGAAGAAACAAGACAAATTTGTATGGACATAGGAAGCCGAAGAGGCATTCATTGCACTCAAG[T/C]
GCTACCTATCAAACCCCCCTGTACTTGTTGCTCCCCAACCTAATGAAGAATTATTCCTCTATATTGCCGCCACGCCACACTCCGTTAGCACTGTCATTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.70% | 10.20% | 22.24% | 33.92% | NA |
| All Indica | 2759 | 8.00% | 3.20% | 31.71% | 57.12% | NA |
| All Japonica | 1512 | 85.80% | 13.00% | 0.93% | 0.20% | NA |
| Aus | 269 | 4.80% | 38.30% | 54.65% | 2.23% | NA |
| Indica I | 595 | 5.20% | 2.00% | 24.87% | 67.90% | NA |
| Indica II | 465 | 4.90% | 4.30% | 38.28% | 52.47% | NA |
| Indica III | 913 | 11.10% | 2.70% | 31.54% | 54.65% | NA |
| Indica Intermediate | 786 | 8.40% | 3.80% | 33.21% | 54.58% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 60.30% | 36.90% | 2.58% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 80.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 46.70% | 17.80% | 16.67% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228028944 | A -> G | LOC_Os02g46000.1 | missense_variant ; p.Cys262Arg; MODERATE | nonsynonymous_codon ; C262R | Average:20.617; most accessible tissue: Minghui63 root, score: 29.362 | unknown | unknown | TOLERATED | 1.00 |
| vg0228028944 | A -> DEL | LOC_Os02g46000.1 | N | frameshift_variant | Average:20.617; most accessible tissue: Minghui63 root, score: 29.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228028944 | NA | 2.06E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 7.29E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 4.51E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 1.12E-06 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 1.70E-19 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | 3.99E-06 | 1.74E-34 | mr1257_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 3.02E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 4.25E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 1.68E-17 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228028944 | NA | 4.93E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |