\
| Variant ID: vg0227974018 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27974018 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATTTTGCCTCCCTCGAGTTCGTGGGCCAATCTCTTCTCCCCGGCCCATTTCCTCCTCAGCCCAACTCTCCTCTCCCCTCCATCCTTGCCCGCACATGTG[A/T]
GGCACGTGCGCCGCTCGGGCGCTGAGCGAGAGAGAGACTCTCTCTCTCTCTTTCACTTCTCCCTCCCTCTCTGCTCTCGTTGCCACTTCCCGCCGATGCC
GGCATCGGCGGGAAGTGGCAACGAGAGCAGAGAGGGAGGGAGAAGTGAAAGAGAGAGAGAGAGTCTCTCTCTCGCTCAGCGCCCGAGCGGCGCACGTGCC[T/A]
CACATGTGCGGGCAAGGATGGAGGGGAGAGGAGAGTTGGGCTGAGGAGGAAATGGGCCGGGGAGAAGAGATTGGCCCACGAACTCGAGGGAGGCAAAATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.20% | 1.10% | 6.05% | 2.71% | NA |
| All Indica | 2759 | 88.80% | 0.10% | 6.60% | 4.53% | NA |
| All Japonica | 1512 | 92.00% | 3.00% | 4.96% | 0.00% | NA |
| Aus | 269 | 90.70% | 0.00% | 9.29% | 0.00% | NA |
| Indica I | 595 | 85.70% | 0.00% | 7.39% | 6.89% | NA |
| Indica II | 465 | 86.50% | 0.00% | 10.11% | 3.44% | NA |
| Indica III | 913 | 92.00% | 0.00% | 4.16% | 3.83% | NA |
| Indica Intermediate | 786 | 88.70% | 0.40% | 6.74% | 4.20% | NA |
| Temperate Japonica | 767 | 85.40% | 6.00% | 8.60% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 2.20% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227974018 | A -> T | LOC_Os02g45900.1 | upstream_gene_variant ; 1985.0bp to feature; MODIFIER | silent_mutation | Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0227974018 | A -> T | LOC_Os02g45910.1 | downstream_gene_variant ; 3569.0bp to feature; MODIFIER | silent_mutation | Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0227974018 | A -> T | LOC_Os02g45900-LOC_Os02g45910 | intergenic_region ; MODIFIER | silent_mutation | Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0227974018 | A -> DEL | N | N | silent_mutation | Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227974018 | 1.91E-06 | 3.63E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227974018 | NA | 1.40E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227974018 | NA | 2.05E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227974018 | 5.47E-06 | 5.40E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227974018 | 3.00E-06 | 8.39E-08 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227974018 | 1.41E-06 | 1.34E-07 | mr1409_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227974018 | 5.86E-07 | 1.99E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |