\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227974018:

Variant ID: vg0227974018 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27974018
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTTGCCTCCCTCGAGTTCGTGGGCCAATCTCTTCTCCCCGGCCCATTTCCTCCTCAGCCCAACTCTCCTCTCCCCTCCATCCTTGCCCGCACATGTG[A/T]
GGCACGTGCGCCGCTCGGGCGCTGAGCGAGAGAGAGACTCTCTCTCTCTCTTTCACTTCTCCCTCCCTCTCTGCTCTCGTTGCCACTTCCCGCCGATGCC

Reverse complement sequence

GGCATCGGCGGGAAGTGGCAACGAGAGCAGAGAGGGAGGGAGAAGTGAAAGAGAGAGAGAGAGTCTCTCTCTCGCTCAGCGCCCGAGCGGCGCACGTGCC[T/A]
CACATGTGCGGGCAAGGATGGAGGGGAGAGGAGAGTTGGGCTGAGGAGGAAATGGGCCGGGGAGAAGAGATTGGCCCACGAACTCGAGGGAGGCAAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 1.10% 6.05% 2.71% NA
All Indica  2759 88.80% 0.10% 6.60% 4.53% NA
All Japonica  1512 92.00% 3.00% 4.96% 0.00% NA
Aus  269 90.70% 0.00% 9.29% 0.00% NA
Indica I  595 85.70% 0.00% 7.39% 6.89% NA
Indica II  465 86.50% 0.00% 10.11% 3.44% NA
Indica III  913 92.00% 0.00% 4.16% 3.83% NA
Indica Intermediate  786 88.70% 0.40% 6.74% 4.20% NA
Temperate Japonica  767 85.40% 6.00% 8.60% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 97.50% 0.00% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 2.20% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227974018 A -> T LOC_Os02g45900.1 upstream_gene_variant ; 1985.0bp to feature; MODIFIER silent_mutation Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0227974018 A -> T LOC_Os02g45910.1 downstream_gene_variant ; 3569.0bp to feature; MODIFIER silent_mutation Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0227974018 A -> T LOC_Os02g45900-LOC_Os02g45910 intergenic_region ; MODIFIER silent_mutation Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0227974018 A -> DEL N N silent_mutation Average:46.906; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227974018 1.91E-06 3.63E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227974018 NA 1.40E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227974018 NA 2.05E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227974018 5.47E-06 5.40E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227974018 3.00E-06 8.39E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227974018 1.41E-06 1.34E-07 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227974018 5.86E-07 1.99E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251