Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0227972814:

Variant ID: vg0227972814 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 27972814
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGACAGCTAGACAGGAGGGATGGGATTGGGCCTTTTCTCTTTTTGTCTATCTATTAAGATAAATCTAATGGTAAAAAAATAATGAGACCATGGTAAAAG[G/A]
CATATTTCATATAAATTATGAGTATATGTGATTTTTTTTAATTATTTCATATTTTATTAAGTCAATTTAGATGACATGTAAAAAAAGTAGGGATGTTGTC

Reverse complement sequence

GACAACATCCCTACTTTTTTTACATGTCATCTAAATTGACTTAATAAAATATGAAATAATTAAAAAAAATCACATATACTCATAATTTATATGAAATATG[C/T]
CTTTTACCATGGTCTCATTATTTTTTTACCATTAGATTTATCTTAATAGATAGACAAAAAGAGAAAAGGCCCAATCCCATCCCTCCTGTCTAGCTGTCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	4.70%	0.66%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	84.10%	13.80%	2.05%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	69.80%	26.60%	3.65%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	1.20%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0227972814	G -> A	LOC_Os02g45890.1	upstream_gene_variant ; 3970.0bp to feature; MODIFIER	silent_mutation	Average:33.029; most accessible tissue: Callus, score: 56.411	N	N	N	N
vg0227972814	G -> A	LOC_Os02g45900.1	upstream_gene_variant ; 781.0bp to feature; MODIFIER	silent_mutation	Average:33.029; most accessible tissue: Callus, score: 56.411	N	N	N	N
vg0227972814	G -> A	LOC_Os02g45910.1	downstream_gene_variant ; 4773.0bp to feature; MODIFIER	silent_mutation	Average:33.029; most accessible tissue: Callus, score: 56.411	N	N	N	N
vg0227972814	G -> A	LOC_Os02g45900-LOC_Os02g45910	intergenic_region ; MODIFIER	silent_mutation	Average:33.029; most accessible tissue: Callus, score: 56.411	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0227972814	NA	9.75E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814	9.98E-07	2.58E-06	mr1321_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814	NA	1.43E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814	8.20E-06	4.42E-07	mr1332_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814	NA	7.60E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814	NA	1.72E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814	NA	1.27E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814	NA	7.71E-06	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251