\
| Variant ID: vg0227972814 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27972814 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGACAGCTAGACAGGAGGGATGGGATTGGGCCTTTTCTCTTTTTGTCTATCTATTAAGATAAATCTAATGGTAAAAAAATAATGAGACCATGGTAAAAG[G/A]
CATATTTCATATAAATTATGAGTATATGTGATTTTTTTTAATTATTTCATATTTTATTAAGTCAATTTAGATGACATGTAAAAAAAGTAGGGATGTTGTC
GACAACATCCCTACTTTTTTTACATGTCATCTAAATTGACTTAATAAAATATGAAATAATTAAAAAAAATCACATATACTCATAATTTATATGAAATATG[C/T]
CTTTTACCATGGTCTCATTATTTTTTTACCATTAGATTTATCTTAATAGATAGACAAAAAGAGAAAAGGCCCAATCCCATCCCTCCTGTCTAGCTGTCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.70% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.10% | 13.80% | 2.05% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 69.80% | 26.60% | 3.65% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227972814 | G -> A | LOC_Os02g45890.1 | upstream_gene_variant ; 3970.0bp to feature; MODIFIER | silent_mutation | Average:33.029; most accessible tissue: Callus, score: 56.411 | N | N | N | N |
| vg0227972814 | G -> A | LOC_Os02g45900.1 | upstream_gene_variant ; 781.0bp to feature; MODIFIER | silent_mutation | Average:33.029; most accessible tissue: Callus, score: 56.411 | N | N | N | N |
| vg0227972814 | G -> A | LOC_Os02g45910.1 | downstream_gene_variant ; 4773.0bp to feature; MODIFIER | silent_mutation | Average:33.029; most accessible tissue: Callus, score: 56.411 | N | N | N | N |
| vg0227972814 | G -> A | LOC_Os02g45900-LOC_Os02g45910 | intergenic_region ; MODIFIER | silent_mutation | Average:33.029; most accessible tissue: Callus, score: 56.411 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227972814 | NA | 9.75E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227972814 | 9.98E-07 | 2.58E-06 | mr1321_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227972814 | NA | 1.43E-07 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227972814 | 8.20E-06 | 4.42E-07 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227972814 | NA | 7.60E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227972814 | NA | 1.72E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227972814 | NA | 1.27E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227972814 | NA | 7.71E-06 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |