\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227972814:

Variant ID: vg0227972814 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27972814
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGACAGCTAGACAGGAGGGATGGGATTGGGCCTTTTCTCTTTTTGTCTATCTATTAAGATAAATCTAATGGTAAAAAAATAATGAGACCATGGTAAAAG[G/A]
CATATTTCATATAAATTATGAGTATATGTGATTTTTTTTAATTATTTCATATTTTATTAAGTCAATTTAGATGACATGTAAAAAAAGTAGGGATGTTGTC

Reverse complement sequence

GACAACATCCCTACTTTTTTTACATGTCATCTAAATTGACTTAATAAAATATGAAATAATTAAAAAAAATCACATATACTCATAATTTATATGAAATATG[C/T]
CTTTTACCATGGTCTCATTATTTTTTTACCATTAGATTTATCTTAATAGATAGACAAAAAGAGAAAAGGCCCAATCCCATCCCTCCTGTCTAGCTGTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.70% 0.66% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 84.10% 13.80% 2.05% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 69.80% 26.60% 3.65% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 1.20% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227972814 G -> A LOC_Os02g45890.1 upstream_gene_variant ; 3970.0bp to feature; MODIFIER silent_mutation Average:33.029; most accessible tissue: Callus, score: 56.411 N N N N
vg0227972814 G -> A LOC_Os02g45900.1 upstream_gene_variant ; 781.0bp to feature; MODIFIER silent_mutation Average:33.029; most accessible tissue: Callus, score: 56.411 N N N N
vg0227972814 G -> A LOC_Os02g45910.1 downstream_gene_variant ; 4773.0bp to feature; MODIFIER silent_mutation Average:33.029; most accessible tissue: Callus, score: 56.411 N N N N
vg0227972814 G -> A LOC_Os02g45900-LOC_Os02g45910 intergenic_region ; MODIFIER silent_mutation Average:33.029; most accessible tissue: Callus, score: 56.411 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227972814 NA 9.75E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814 9.98E-07 2.58E-06 mr1321_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814 NA 1.43E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814 8.20E-06 4.42E-07 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814 NA 7.60E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814 NA 1.72E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814 NA 1.27E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227972814 NA 7.71E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251