Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227924870:

Variant ID: vg0227924870 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 27924870
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGATTCTATTCCAACATACCCTATTGCACTCTTTCTCCTTGTGCTCGATCCCTTTTGGATTCTGTTCCAACATACCTCCATTTATTAAATAGATGACG[T/C]
CATTGACTTTTAGACACACATTTGATCATTTATAATATTAATTTTTTACATAATTATAATTTATTTTGCAGCGAGTTATTGTGCCACTAAAAAGTATTAT

Reverse complement sequence

ATAATACTTTTTAGTGGCACAATAACTCGCTGCAAAATAAATTATAATTATGTAAAAAATTAATATTATAAATGATCAAATGTGTGTCTAAAAGTCAATG[A/G]
CGTCATCTATTTAATAAATGGAGGTATGTTGGAACAGAATCCAAAAGGGATCGAGCACAAGGAGAAAGAGTGCAATAGGGTATGTTGGAATAGAATCCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	24.70%	0.85%	0.00%	NA
All Indica	2759	95.20%	4.50%	0.33%	0.00%	NA
All Japonica	1512	32.20%	66.10%	1.65%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	97.50%	2.20%	0.34%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	91.80%	8.10%	0.11%	0.00%	NA
Indica Intermediate	786	95.40%	3.80%	0.76%	0.00%	NA
Temperate Japonica	767	36.00%	61.50%	2.48%	0.00%	NA
Tropical Japonica	504	36.30%	63.10%	0.60%	0.00%	NA
Japonica Intermediate	241	11.60%	87.10%	1.24%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	66.70%	30.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0227924870	T -> C	LOC_Os02g45840.1	downstream_gene_variant ; 1199.0bp to feature; MODIFIER	silent_mutation	Average:35.434; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0227924870	T -> C	LOC_Os02g45840-LOC_Os02g45850	intergenic_region ; MODIFIER	silent_mutation	Average:35.434; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0227924870	NA	4.41E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	1.33E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	6.43E-12	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	4.00E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	1.00E-19	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	3.70E-06	NA	mr1164_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	2.63E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	2.89E-06	mr1321_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	9.22E-07	mr1332_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	8.23E-06	mr1380_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	2.36E-06	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	1.31E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	1.02E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	6.79E-07	mr1994_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870	NA	6.42E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251