\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227924870:

Variant ID: vg0227924870 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27924870
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGATTCTATTCCAACATACCCTATTGCACTCTTTCTCCTTGTGCTCGATCCCTTTTGGATTCTGTTCCAACATACCTCCATTTATTAAATAGATGACG[T/C]
CATTGACTTTTAGACACACATTTGATCATTTATAATATTAATTTTTTACATAATTATAATTTATTTTGCAGCGAGTTATTGTGCCACTAAAAAGTATTAT

Reverse complement sequence

ATAATACTTTTTAGTGGCACAATAACTCGCTGCAAAATAAATTATAATTATGTAAAAAATTAATATTATAAATGATCAAATGTGTGTCTAAAAGTCAATG[A/G]
CGTCATCTATTTAATAAATGGAGGTATGTTGGAACAGAATCCAAAAGGGATCGAGCACAAGGAGAAAGAGTGCAATAGGGTATGTTGGAATAGAATCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 24.70% 0.85% 0.00% NA
All Indica  2759 95.20% 4.50% 0.33% 0.00% NA
All Japonica  1512 32.20% 66.10% 1.65% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 97.50% 2.20% 0.34% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 91.80% 8.10% 0.11% 0.00% NA
Indica Intermediate  786 95.40% 3.80% 0.76% 0.00% NA
Temperate Japonica  767 36.00% 61.50% 2.48% 0.00% NA
Tropical Japonica  504 36.30% 63.10% 0.60% 0.00% NA
Japonica Intermediate  241 11.60% 87.10% 1.24% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 66.70% 30.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227924870 T -> C LOC_Os02g45840.1 downstream_gene_variant ; 1199.0bp to feature; MODIFIER silent_mutation Average:35.434; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0227924870 T -> C LOC_Os02g45840-LOC_Os02g45850 intergenic_region ; MODIFIER silent_mutation Average:35.434; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227924870 NA 4.41E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 1.33E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 6.43E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 4.00E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 1.00E-19 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 3.70E-06 NA mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 2.63E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 2.89E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 9.22E-07 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 8.23E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 2.36E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 1.31E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 1.02E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 6.79E-07 mr1994_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227924870 NA 6.42E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251