Search for Variation information by Variation ID:
Detailed information for vg0227894878:
| Variant ID: vg0227894878 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27894878 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TCCTCGAGGGGTCATATCACTACGGAGCGACATCAAGCAAGCCGTCACATGTGACAAAGAAAGTTGCGAGATGGCCCAAACCCACGAGACCACTCTCGCC[C/T]
GCGAAGAGATCCGACTGGCTGCGACCACGGCAAGCGAGGGAGAAGTGCCTGCAACCAAGCTGACGAAGACCGAAGAAAGTGATGCCAAGACGAAAAAGAT
Reverse complement sequence
ATCTTTTTCGTCTTGGCATCACTTTCTTCGGTCTTCGTCAGCTTGGTTGCAGGCACTTCTCCCTCGCTTGCCGTGGTCGCAGCCAGTCGGATCTCTTCGC[G/A]
GGCGAGAGTGGTCTCGTGGGTTTGGGCCATCTCGCAACTTTCTTTGTCACATGTGACGGCTTGCTTGATGTCGCTCCGTAGTGATATGACCCCTCGAGGA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.90% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 85.20% | 13.20% | 1.59% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 71.80% | 25.30% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227894878 | C -> T | LOC_Os02g45790.1 | missense_variant ; p.Arg624Cys; MODERATE | nonsynonymous_codon ; R624C | Average:29.684; most accessible tissue: Zhenshan97 flower, score: 46.765 | probably damaging  |
3.187 |
DELETERIOUS | 0.01 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227894878 | 6.99E-06 | 8.36E-10 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 6.09E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 1.32E-06 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 4.80E-06 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 4.49E-06 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 6.93E-06 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | 3.19E-07 | 4.57E-11 | mr1354_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 3.86E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 4.22E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227894878 | NA | 1.70E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |