\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227894878:

Variant ID: vg0227894878 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27894878
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTCGAGGGGTCATATCACTACGGAGCGACATCAAGCAAGCCGTCACATGTGACAAAGAAAGTTGCGAGATGGCCCAAACCCACGAGACCACTCTCGCC[C/T]
GCGAAGAGATCCGACTGGCTGCGACCACGGCAAGCGAGGGAGAAGTGCCTGCAACCAAGCTGACGAAGACCGAAGAAAGTGATGCCAAGACGAAAAAGAT

Reverse complement sequence

ATCTTTTTCGTCTTGGCATCACTTTCTTCGGTCTTCGTCAGCTTGGTTGCAGGCACTTCTCCCTCGCTTGCCGTGGTCGCAGCCAGTCGGATCTCTTCGC[G/A]
GGCGAGAGTGGTCTCGTGGGTTTGGGCCATCTCGCAACTTTCTTTGTCACATGTGACGGCTTGCTTGATGTCGCTCCGTAGTGATATGACCCCTCGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.90% 0.57% 0.00% NA
All Indica  2759 99.00% 0.90% 0.11% 0.00% NA
All Japonica  1512 85.20% 13.20% 1.59% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.80% 0.38% 0.00% NA
Temperate Japonica  767 71.80% 25.30% 2.87% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227894878 C -> T LOC_Os02g45790.1 missense_variant ; p.Arg624Cys; MODERATE nonsynonymous_codon ; R624C Average:29.684; most accessible tissue: Zhenshan97 flower, score: 46.765 probably damaging 3.187 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227894878 6.99E-06 8.36E-10 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 6.09E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 1.32E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 4.80E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 4.49E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 6.93E-06 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 3.19E-07 4.57E-11 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 3.86E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 4.22E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227894878 NA 1.70E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251