\
| Variant ID: vg0227859855 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27859855 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCACTAAAGTTGTAGTTTTTCTAAAATTTACTCTTATGTAAGCATAAATAAATAGTTTTCAAAAATAAATTCTAGAGTATCATAGTTTAGCCTGAGCACG[T/G]
ATGCATGGGAAGCTACCCTGTTCGTTTCATATTATAAATTTTTTTATAACTTGTTTAAGCTTGACAATATTTATAGAAAAATGTACCTATGCCTTGAATA
TATTCAAGGCATAGGTACATTTTTCTATAAATATTGTCAAGCTTAAACAAGTTATAAAAAAATTTATAATATGAAACGAACAGGGTAGCTTCCCATGCAT[A/C]
CGTGCTCAGGCTAAACTATGATACTCTAGAATTTATTTTTGAAAACTATTTATTTATGCTTACATAAGAGTAAATTTTAGAAAAACTACAACTTTAGTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 2.80% | 1.76% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 87.10% | 7.70% | 5.16% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 76.10% | 15.10% | 8.74% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227859855 | T -> G | LOC_Os02g45760.1 | upstream_gene_variant ; 3692.0bp to feature; MODIFIER | silent_mutation | Average:35.109; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0227859855 | T -> G | LOC_Os02g45760-LOC_Os02g45770 | intergenic_region ; MODIFIER | silent_mutation | Average:35.109; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227859855 | 5.37E-06 | 5.46E-07 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227859855 | NA | 5.59E-07 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227859855 | 2.60E-07 | 2.60E-07 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227859855 | NA | 2.09E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227859855 | 4.19E-06 | 4.19E-06 | mr1647_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227859855 | 4.85E-06 | 4.85E-06 | mr1760_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |