\
| Variant ID: vg0227802642 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27802642 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 345. )
TTTGACAAGTTTGGAATATTAGTGATTTTTACCTCTCTTGCACTTCGATGTGAAATAAATCAGGGCTTCACAAGCACTTGCTATGGTAAACTGGTACCGA[C/T]
TGGTATGTCCTAGTGGTATAGTCTGCACTGATGTGTATGCATGTTTCGTACACAACTGCATATTGACACGAGCTCTACAGAGAACCATGGTTTCGAGCGA
TCGCTCGAAACCATGGTTCTCTGTAGAGCTCGTGTCAATATGCAGTTGTGTACGAAACATGCATACACATCAGTGCAGACTATACCACTAGGACATACCA[G/A]
TCGGTACCAGTTTACCATAGCAAGTGCTTGTGAAGCCCTGATTTATTTCACATCGAAGTGCAAGAGAGGTAAAAATCACTAATATTCCAAACTTGTCAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 9.70% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.20% | 12.20% | 0.60% | 0.00% | NA |
| Aus | 269 | 47.20% | 51.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.80% | 29.80% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 9.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227802642 | C -> T | LOC_Os02g45700.1 | downstream_gene_variant ; 756.0bp to feature; MODIFIER | silent_mutation | Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 | N | N | N | N |
| vg0227802642 | C -> T | LOC_Os02g45710.1 | downstream_gene_variant ; 4410.0bp to feature; MODIFIER | silent_mutation | Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 | N | N | N | N |
| vg0227802642 | C -> T | LOC_Os02g45700.2 | downstream_gene_variant ; 756.0bp to feature; MODIFIER | silent_mutation | Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 | N | N | N | N |
| vg0227802642 | C -> T | LOC_Os02g45690.1 | intron_variant ; MODIFIER | silent_mutation | Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227802642 | NA | 9.24E-07 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 8.87E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 1.35E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 6.23E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 3.51E-06 | mr1725 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 1.44E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 6.63E-07 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 4.83E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 1.11E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 1.37E-07 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | 1.95E-06 | 1.18E-09 | mr1653_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227802642 | NA | 3.66E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |