\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227802642:

Variant ID: vg0227802642 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27802642
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGACAAGTTTGGAATATTAGTGATTTTTACCTCTCTTGCACTTCGATGTGAAATAAATCAGGGCTTCACAAGCACTTGCTATGGTAAACTGGTACCGA[C/T]
TGGTATGTCCTAGTGGTATAGTCTGCACTGATGTGTATGCATGTTTCGTACACAACTGCATATTGACACGAGCTCTACAGAGAACCATGGTTTCGAGCGA

Reverse complement sequence

TCGCTCGAAACCATGGTTCTCTGTAGAGCTCGTGTCAATATGCAGTTGTGTACGAAACATGCATACACATCAGTGCAGACTATACCACTAGGACATACCA[G/A]
TCGGTACCAGTTTACCATAGCAAGTGCTTGTGAAGCCCTGATTTATTTCACATCGAAGTGCAAGAGAGGTAAAAATCACTAATATTCCAAACTTGTCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 9.70% 0.25% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 87.20% 12.20% 0.60% 0.00% NA
Aus  269 47.20% 51.70% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 68.80% 29.80% 1.39% 0.00% NA
Japonica Intermediate  241 89.60% 9.50% 0.83% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227802642 C -> T LOC_Os02g45700.1 downstream_gene_variant ; 756.0bp to feature; MODIFIER silent_mutation Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 N N N N
vg0227802642 C -> T LOC_Os02g45710.1 downstream_gene_variant ; 4410.0bp to feature; MODIFIER silent_mutation Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 N N N N
vg0227802642 C -> T LOC_Os02g45700.2 downstream_gene_variant ; 756.0bp to feature; MODIFIER silent_mutation Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 N N N N
vg0227802642 C -> T LOC_Os02g45690.1 intron_variant ; MODIFIER silent_mutation Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227802642 NA 9.24E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 8.87E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 1.35E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 6.23E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 3.51E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 1.44E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 6.63E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 4.83E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 1.11E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 1.37E-07 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 1.95E-06 1.18E-09 mr1653_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642 NA 3.66E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251