\
| Variant ID: vg0227637893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27637893 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGGACCCATATTATATTTTTTGTGTTTTTTATTTCAATAGGATTTGAGAAGCATATTATTTCAATTCTTGTATTTTTCTTATTTATTTGTTTTTCCTATC[C/T]
TGCAAATTAAAGGGACCCTAAATTTTGTTTCAAAATAAATCAATTTCTATATTTTGAATTTTAAAGTTGATTTTGAGATATTCTCAACGTGGTTTTTTTC
GAAAAAAACCACGTTGAGAATATCTCAAAATCAACTTTAAAATTCAAAATATAGAAATTGATTTATTTTGAAACAAAATTTAGGGTCCCTTTAATTTGCA[G/A]
GATAGGAAAAACAAATAAATAAGAAAAATACAAGAATTGAAATAATATGCTTCTCAAATCCTATTGAAATAAAAAACACAAAAAATATAATATGGGTCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 4.70% | 1.71% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.60% | 14.20% | 5.22% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 69.10% | 22.00% | 8.87% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 19.10% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227637893 | C -> T | LOC_Os02g45420-LOC_Os02g45440 | intergenic_region ; MODIFIER | silent_mutation | Average:38.586; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227637893 | 7.22E-08 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | 6.51E-06 | 5.18E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | 2.56E-09 | NA | mr1305 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | 1.37E-06 | 1.17E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | NA | 1.68E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | 8.77E-10 | NA | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | 1.79E-06 | 5.28E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | NA | 1.93E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227637893 | NA | 1.84E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |