\
| Variant ID: vg0227395695 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27395695 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )
ATAATAGTAATTGCTAGTGAGTGAAGATGTGGCATGCTTGCATGGGATTTTAAATGGGTTAGAACAGTAATTGCTAGTGAGTGATGATGTGGCATGCTTG[T/C]
ATGTTGAGCTTTAGCTTCTAATAATTATTAGTGGGTACCAACTATATAGAAAGTATAGATTGTTTCACCTGCTTCCTATTTGAATGACCTCCAATAATTA
TAATTATTGGAGGTCATTCAAATAGGAAGCAGGTGAAACAATCTATACTTTCTATATAGTTGGTACCCACTAATAATTATTAGAAGCTAAAGCTCAACAT[A/G]
CAAGCATGCCACATCATCACTCACTAGCAATTACTGTTCTAACCCATTTAAAATCCCATGCAAGCATGCCACATCTTCACTCACTAGCAATTACTATTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.20% | 10.80% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 66.10% | 30.80% | 3.11% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 42.90% | 52.40% | 4.69% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 2.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 20.70% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227395695 | T -> C | LOC_Os02g45160.1 | upstream_gene_variant ; 1507.0bp to feature; MODIFIER | silent_mutation | Average:41.19; most accessible tissue: Callus, score: 73.182 | N | N | N | N |
| vg0227395695 | T -> C | LOC_Os02g45160-LOC_Os02g45170 | intergenic_region ; MODIFIER | silent_mutation | Average:41.19; most accessible tissue: Callus, score: 73.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227395695 | NA | 2.74E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | 9.78E-08 | 5.12E-24 | mr1163 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | 9.53E-06 | 1.84E-12 | mr1163 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 5.64E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 1.45E-14 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 2.46E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 5.38E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 8.96E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 1.98E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 7.73E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 5.50E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 4.35E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227395695 | NA | 4.36E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |