\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227395695:

Variant ID: vg0227395695 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27395695
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATAGTAATTGCTAGTGAGTGAAGATGTGGCATGCTTGCATGGGATTTTAAATGGGTTAGAACAGTAATTGCTAGTGAGTGATGATGTGGCATGCTTG[T/C]
ATGTTGAGCTTTAGCTTCTAATAATTATTAGTGGGTACCAACTATATAGAAAGTATAGATTGTTTCACCTGCTTCCTATTTGAATGACCTCCAATAATTA

Reverse complement sequence

TAATTATTGGAGGTCATTCAAATAGGAAGCAGGTGAAACAATCTATACTTTCTATATAGTTGGTACCCACTAATAATTATTAGAAGCTAAAGCTCAACAT[A/G]
CAAGCATGCCACATCATCACTCACTAGCAATTACTGTTCTAACCCATTTAAAATCCCATGCAAGCATGCCACATCTTCACTCACTAGCAATTACTATTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 10.80% 1.04% 0.00% NA
All Indica  2759 98.80% 1.10% 0.07% 0.00% NA
All Japonica  1512 66.10% 30.80% 3.11% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.00% 0.13% 0.00% NA
Temperate Japonica  767 42.90% 52.40% 4.69% 0.00% NA
Tropical Japonica  504 96.60% 2.80% 0.60% 0.00% NA
Japonica Intermediate  241 75.90% 20.70% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227395695 T -> C LOC_Os02g45160.1 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:41.19; most accessible tissue: Callus, score: 73.182 N N N N
vg0227395695 T -> C LOC_Os02g45160-LOC_Os02g45170 intergenic_region ; MODIFIER silent_mutation Average:41.19; most accessible tissue: Callus, score: 73.182 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227395695 NA 2.74E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 9.78E-08 5.12E-24 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 9.53E-06 1.84E-12 mr1163 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 5.64E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 1.45E-14 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 2.46E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 5.38E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 8.96E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 1.98E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 7.73E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 5.50E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 4.35E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695 NA 4.36E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251