\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227378385:

Variant ID: vg0227378385 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27378385
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AAGACAATAAAAATCACTAAAATTTTAAACTTTTTAAAATTTTTACATCATGCTGGATGTTATGGTTGCTTTTGCTTGCCAAACTATAAATTGTCATAAT[G/A]
GAAAATTAAACTAAAGTTATACAACTAAGTAATAATTATAATAATAAGATATTTATTATGAACCCTATAAATATTTACGTACAAGAAAACAAAGCCAGAA

Reverse complement sequence

TTCTGGCTTTGTTTTCTTGTACGTAAATATTTATAGGGTTCATAATAAATATCTTATTATTATAATTATTACTTAGTTGTATAACTTTAGTTTAATTTTC[C/T]
ATTATGACAATTTATAGTTTGGCAAGCAAAAGCAACCATAACATCCAGCATGATGTAAAAATTTTAAAAAGTTTAAAATTTTAGTGATTTTTATTGTCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.60% 0.13% 0.04% NA
All Indica  2759 97.40% 2.40% 0.18% 0.07% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 4.70% 0.38% 0.25% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227378385 G -> A LOC_Os02g45130.1 upstream_gene_variant ; 1622.0bp to feature; MODIFIER silent_mutation Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0227378385 G -> A LOC_Os02g45130.2 upstream_gene_variant ; 3562.0bp to feature; MODIFIER silent_mutation Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0227378385 G -> A LOC_Os02g45140.1 intron_variant ; MODIFIER silent_mutation Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0227378385 G -> DEL N N silent_mutation Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227378385 NA 5.35E-27 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385 NA 8.44E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385 NA 3.42E-28 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385 NA 4.80E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385 NA 2.99E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385 9.20E-07 9.20E-07 mr1335_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385 NA 7.21E-33 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251