\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227173147:

Variant ID: vg0227173147 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 27173147
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGAAGAGATAAGGTGTAAAGAGTTAGATAGGAGGAGCCGGGAGTTAAAGGAGAGAGGAGCGGGAGGGAGGAGGAGACCTCGATCCTATCCGCGCGCAC[G/C]
CCTCCCTGTGCATATCGATCTTTTTTCCCGGTTAGTGTTACCAACCGGGACTACAAATAGATCTTTAGTCTCGGTTGGTAATACTAACCGGGACTAAAGA

Reverse complement sequence

TCTTTAGTCCCGGTTAGTATTACCAACCGAGACTAAAGATCTATTTGTAGTCCCGGTTGGTAACACTAACCGGGAAAAAAGATCGATATGCACAGGGAGG[C/G]
GTGCGCGCGGATAGGATCGAGGTCTCCTCCTCCCTCCCGCTCCTCTCTCCTTTAACTCCCGGCTCCTCCTATCTAACTCTTTACACCTTATCTCTTCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 17.90% 7.07% 0.00% NA
All Indica  2759 58.10% 30.00% 11.89% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 27.70% 44.00% 28.24% 0.00% NA
Indica II  465 43.00% 44.70% 12.26% 0.00% NA
Indica III  913 86.60% 11.30% 2.08% 0.00% NA
Indica Intermediate  786 56.70% 32.60% 10.69% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 12.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0227173147 G -> C LOC_Os02g44870-LOC_Os02g44880 intergenic_region ; MODIFIER silent_mutation Average:60.904; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0227173147 NA 5.20E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 NA 1.29E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 NA 6.66E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 NA 7.93E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 NA 5.57E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 NA 4.55E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 NA 1.47E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 4.66E-06 NA mr1947 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227173147 NA 2.09E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251