\
| Variant ID: vg0227173147 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27173147 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )
GAGGAAGAGATAAGGTGTAAAGAGTTAGATAGGAGGAGCCGGGAGTTAAAGGAGAGAGGAGCGGGAGGGAGGAGGAGACCTCGATCCTATCCGCGCGCAC[G/C]
CCTCCCTGTGCATATCGATCTTTTTTCCCGGTTAGTGTTACCAACCGGGACTACAAATAGATCTTTAGTCTCGGTTGGTAATACTAACCGGGACTAAAGA
TCTTTAGTCCCGGTTAGTATTACCAACCGAGACTAAAGATCTATTTGTAGTCCCGGTTGGTAACACTAACCGGGAAAAAAGATCGATATGCACAGGGAGG[C/G]
GTGCGCGCGGATAGGATCGAGGTCTCCTCCTCCCTCCCGCTCCTCTCTCCTTTAACTCCCGGCTCCTCCTATCTAACTCTTTACACCTTATCTCTTCCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 17.90% | 7.07% | 0.00% | NA |
| All Indica | 2759 | 58.10% | 30.00% | 11.89% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 27.70% | 44.00% | 28.24% | 0.00% | NA |
| Indica II | 465 | 43.00% | 44.70% | 12.26% | 0.00% | NA |
| Indica III | 913 | 86.60% | 11.30% | 2.08% | 0.00% | NA |
| Indica Intermediate | 786 | 56.70% | 32.60% | 10.69% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 12.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227173147 | G -> C | LOC_Os02g44870-LOC_Os02g44880 | intergenic_region ; MODIFIER | silent_mutation | Average:60.904; most accessible tissue: Zhenshan97 flower, score: 78.677 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227173147 | NA | 5.20E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | NA | 1.29E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | NA | 6.66E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | NA | 7.93E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | NA | 5.57E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | NA | 4.55E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | NA | 1.47E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | 4.66E-06 | NA | mr1947 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227173147 | NA | 2.09E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |