\
| Variant ID: vg0227036650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27036650 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 232. )
CCGACACTCGCCCACCAAGAATACAACAGAATACTATCGACGTTTGATGTCTCGACTACGGTATTTGCATGGCATAGGGATCGTTGGTACTAGGATATAC[G/A]
CGAGACTGAGGTAAAAGAGACGGAGACATCGATTTTTATACAGGTTCAGGCCCTTGAATTGTCATGTAATAACCCTACATCCTGTTGGCCGAAGCCGGTC
GACCGGCTTCGGCCAACAGGATGTAGGGTTATTACATGACAATTCAAGGGCCTGAACCTGTATAAAAATCGATGTCTCCGTCTCTTTTACCTCAGTCTCG[C/T]
GTATATCCTAGTACCAACGATCCCTATGCCATGCAAATACCGTAGTCGAGACATCAAACGTCGATAGTATTCTGTTGTATTCTTGGTGGGCGAGTGTCGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 38.00% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 88.60% | 11.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 10.30% | 88.00% | 1.72% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.30% | 20.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.70% | 8.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 17.70% | 79.30% | 3.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.20% | 96.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227036650 | G -> A | LOC_Os02g44620.1 | upstream_gene_variant ; 1818.0bp to feature; MODIFIER | silent_mutation | Average:74.353; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0227036650 | G -> A | LOC_Os02g44610.1 | downstream_gene_variant ; 907.0bp to feature; MODIFIER | silent_mutation | Average:74.353; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0227036650 | G -> A | LOC_Os02g44610-LOC_Os02g44620 | intergenic_region ; MODIFIER | silent_mutation | Average:74.353; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227036650 | NA | 2.37E-06 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0227036650 | NA | 5.97E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 2.65E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 2.03E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 2.91E-06 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 6.61E-19 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 2.48E-07 | mr1380_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | 2.55E-06 | 2.55E-06 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 1.08E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 5.50E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 1.68E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 1.05E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | 3.52E-06 | 3.52E-06 | mr1908_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227036650 | NA | 6.43E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |