Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226906255:

Variant ID: vg0226906255 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26906255
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

CGAAACCACGCTCATTCGTGGTAGATCAATATGTTTATTTTCATATTGCTTATAGAATTAATAGCATGCCTTATGTATTTCCATGGCCGTATTTTTTTTG[G/A]
TAGTTATGCCTGTCAGGGTTACGGATAAGGCATACCCTCTATCCTACGACTTATGGAATATACCGATGAGGTATACCTTCACGTATGCGGGTTGTTTCCG

Reverse complement sequence

CGGAAACAACCCGCATACGTGAAGGTATACCTCATCGGTATATTCCATAAGTCGTAGGATAGAGGGTATGCCTTATCCGTAACCCTGACAGGCATAACTA[C/T]
CAAAAAAAATACGGCCATGGAAATACATAAGGCATGCTATTAATTCTATAAGCAATATGAAAATAAACATATTGATCTACCACGAATGAGCGTGGTTTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.80%	7.90%	4.25%	0.00%	NA
All Indica	2759	79.60%	13.30%	7.03%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	59.30%	21.20%	19.50%	0.00%	NA
Indica II	465	66.00%	28.00%	6.02%	0.00%	NA
Indica III	913	99.70%	0.10%	0.22%	0.00%	NA
Indica Intermediate	786	79.80%	14.10%	6.11%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	4.40%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226906255	G -> A	LOC_Os02g44440.1	upstream_gene_variant ; 1071.0bp to feature; MODIFIER	silent_mutation	Average:33.01; most accessible tissue: Callus, score: 67.216	N	N	N	N
vg0226906255	G -> A	LOC_Os02g44430.1	downstream_gene_variant ; 1706.0bp to feature; MODIFIER	silent_mutation	Average:33.01; most accessible tissue: Callus, score: 67.216	N	N	N	N
vg0226906255	G -> A	LOC_Os02g44430-LOC_Os02g44440	intergenic_region ; MODIFIER	silent_mutation	Average:33.01; most accessible tissue: Callus, score: 67.216	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226906255	NA	8.66E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255	NA	1.46E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255	NA	2.41E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255	NA	5.18E-06	mr1198_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255	NA	5.04E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255	NA	1.40E-07	mr1321_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251