\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226906255:

Variant ID: vg0226906255 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26906255
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAACCACGCTCATTCGTGGTAGATCAATATGTTTATTTTCATATTGCTTATAGAATTAATAGCATGCCTTATGTATTTCCATGGCCGTATTTTTTTTG[G/A]
TAGTTATGCCTGTCAGGGTTACGGATAAGGCATACCCTCTATCCTACGACTTATGGAATATACCGATGAGGTATACCTTCACGTATGCGGGTTGTTTCCG

Reverse complement sequence

CGGAAACAACCCGCATACGTGAAGGTATACCTCATCGGTATATTCCATAAGTCGTAGGATAGAGGGTATGCCTTATCCGTAACCCTGACAGGCATAACTA[C/T]
CAAAAAAAATACGGCCATGGAAATACATAAGGCATGCTATTAATTCTATAAGCAATATGAAAATAAACATATTGATCTACCACGAATGAGCGTGGTTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 7.90% 4.25% 0.00% NA
All Indica  2759 79.60% 13.30% 7.03% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 59.30% 21.20% 19.50% 0.00% NA
Indica II  465 66.00% 28.00% 6.02% 0.00% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 79.80% 14.10% 6.11% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 4.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226906255 G -> A LOC_Os02g44440.1 upstream_gene_variant ; 1071.0bp to feature; MODIFIER silent_mutation Average:33.01; most accessible tissue: Callus, score: 67.216 N N N N
vg0226906255 G -> A LOC_Os02g44430.1 downstream_gene_variant ; 1706.0bp to feature; MODIFIER silent_mutation Average:33.01; most accessible tissue: Callus, score: 67.216 N N N N
vg0226906255 G -> A LOC_Os02g44430-LOC_Os02g44440 intergenic_region ; MODIFIER silent_mutation Average:33.01; most accessible tissue: Callus, score: 67.216 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226906255 NA 8.66E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255 NA 1.46E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255 NA 2.41E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255 NA 5.18E-06 mr1198_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255 NA 5.04E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226906255 NA 1.40E-07 mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251