\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226903454:

Variant ID: vg0226903454 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26903454
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.22, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTACTAGATAGGTGCCGTACTATCAAGAGGGGTCTATGAAGCTAGCATGTGGATGATTTTGTACCATATTAGTTCATATGCATATAGGTTCATTTTGT[G/A]
GGCTTGTCTAGCCAAGTGTGGTGAGTTTTATCAAGTCCCAAACAAAGAGAGATGTGGGCACATCCTATAGGTTTGGGTAGCCTCATGTGGTTATGTCCGG

Reverse complement sequence

CCGGACATAACCACATGAGGCTACCCAAACCTATAGGATGTGCCCACATCTCTCTTTGTTTGGGACTTGATAAAACTCACCACACTTGGCTAGACAAGCC[C/T]
ACAAAATGAACCTATATGCATATGAACTAATATGGTACAAAATCATCCACATGCTAGCTTCATAGACCCCTCTTGATAGTACGGCACCTATCTAGTAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 38.80% 0.19% 0.00% NA
All Indica  2759 93.20% 6.50% 0.29% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 97.00% 2.60% 0.37% 0.00% NA
Indica I  595 96.60% 2.90% 0.50% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 88.90% 11.10% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.40% 0.51% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226903454 G -> A LOC_Os02g44410.1 upstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg0226903454 G -> A LOC_Os02g44440.1 upstream_gene_variant ; 3872.0bp to feature; MODIFIER silent_mutation Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg0226903454 G -> A LOC_Os02g44420.1 downstream_gene_variant ; 2604.0bp to feature; MODIFIER silent_mutation Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg0226903454 G -> A LOC_Os02g44430.1 intron_variant ; MODIFIER silent_mutation Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226903454 NA 2.45E-27 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 8.62E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 4.87E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 1.56E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 7.21E-08 mr1220 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 1.62E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 2.15E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 5.43E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 8.43E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 6.10E-31 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 7.62E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454 NA 3.67E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251