\
| Variant ID: vg0226903454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 26903454 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.22, others allele: 0.00, population size: 200. )
ATTTACTAGATAGGTGCCGTACTATCAAGAGGGGTCTATGAAGCTAGCATGTGGATGATTTTGTACCATATTAGTTCATATGCATATAGGTTCATTTTGT[G/A]
GGCTTGTCTAGCCAAGTGTGGTGAGTTTTATCAAGTCCCAAACAAAGAGAGATGTGGGCACATCCTATAGGTTTGGGTAGCCTCATGTGGTTATGTCCGG
CCGGACATAACCACATGAGGCTACCCAAACCTATAGGATGTGCCCACATCTCTCTTTGTTTGGGACTTGATAAAACTCACCACACTTGGCTAGACAAGCC[C/T]
ACAAAATGAACCTATATGCATATGAACTAATATGGTACAAAATCATCCACATGCTAGCTTCATAGACCCCTCTTGATAGTACGGCACCTATCTAGTAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 38.80% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 93.20% | 6.50% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.60% | 2.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0226903454 | G -> A | LOC_Os02g44410.1 | upstream_gene_variant ; 4202.0bp to feature; MODIFIER | silent_mutation | Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| vg0226903454 | G -> A | LOC_Os02g44440.1 | upstream_gene_variant ; 3872.0bp to feature; MODIFIER | silent_mutation | Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| vg0226903454 | G -> A | LOC_Os02g44420.1 | downstream_gene_variant ; 2604.0bp to feature; MODIFIER | silent_mutation | Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| vg0226903454 | G -> A | LOC_Os02g44430.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0226903454 | NA | 2.45E-27 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 8.62E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 4.87E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 1.56E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 7.21E-08 | mr1220 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 1.62E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 2.15E-13 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 5.43E-27 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 8.43E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 6.10E-31 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 7.62E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226903454 | NA | 3.67E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |