\
| Variant ID: vg0226753616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 26753616 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 259. )
CTGTCATATGCATTGTTGCTGTGGTGGCTTGCTGAGTACGGTTGGTACTCACCCTTGCAATATACAAACTTAATCAGAGGTCGGAGATGAAGCTTCGGAG[G/A]
ATCCCTATGCCTATTACCAGGAGGGTGATGAAGACAATGGCGCTCAGTAGGTCTTAGTTACGGCCGTTGCCTGTGGCAATGGCGTGCCGCTGCCTTAACT
AGTTAAGGCAGCGGCACGCCATTGCCACAGGCAACGGCCGTAACTAAGACCTACTGAGCGCCATTGTCTTCATCACCCTCCTGGTAATAGGCATAGGGAT[C/T]
CTCCGAAGCTTCATCTCCGACCTCTGATTAAGTTTGTATATTGCAAGGGTGAGTACCAACCGTACTCAGCAAGCCACCACAGCAACAATGCATATGACAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 46.60% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 84.10% | 15.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.00% | 41.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 77.80% | 21.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.60% | 13.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0226753616 | G -> A | LOC_Os02g44190.1 | downstream_gene_variant ; 3495.0bp to feature; MODIFIER | silent_mutation | Average:24.017; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg0226753616 | G -> A | LOC_Os02g44200.1 | downstream_gene_variant ; 1311.0bp to feature; MODIFIER | silent_mutation | Average:24.017; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg0226753616 | G -> A | LOC_Os02g44190-LOC_Os02g44200 | intergenic_region ; MODIFIER | silent_mutation | Average:24.017; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0226753616 | NA | 2.44E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 6.18E-07 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 8.00E-07 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 4.75E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.08E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.72E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 6.30E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 7.27E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.29E-08 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 4.40E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.95E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 4.98E-08 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 7.20E-06 | 7.20E-06 | mr1279_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 4.50E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 8.55E-06 | 8.55E-06 | mr1313_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 7.11E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.63E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 8.94E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.04E-06 | mr1355_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 6.62E-06 | 1.98E-07 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.58E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.40E-06 | mr1462_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 3.29E-06 | 2.37E-07 | mr1470_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 9.15E-06 | mr1472_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 1.67E-06 | 1.67E-06 | mr1473_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.15E-08 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 1.09E-06 | 5.93E-10 | mr1479_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.32E-06 | mr1479_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 1.36E-06 | 2.86E-07 | mr1483_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.31E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 9.61E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 8.42E-07 | 8.42E-07 | mr1630_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 5.33E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.23E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.84E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.10E-12 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 7.84E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | 1.61E-06 | 4.60E-08 | mr1719_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 5.60E-16 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 9.31E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.06E-11 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 2.36E-06 | mr1871_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 4.47E-07 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 1.49E-15 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226753616 | NA | 3.74E-15 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |