Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226752550:

Variant ID: vg0226752550 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26752550
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TATGACAATTGCTTAGAAATGCTATTTTAGAATCATGCATACTCATATTTATAAAATGTTATATGCTTGGGCAATTACCTTTGAGAAGGTAATTGAGATA[C/T]
GGCATGTGGAGACATGAGCGCCACATTGCCCTGATGTTGATGACATAATTTGTGGAAGGAGAAATAAAATTAAACAACTGTTTTCGACTGGGGCGGACAG

Reverse complement sequence

CTGTCCGCCCCAGTCGAAAACAGTTGTTTAATTTTATTTCTCCTTCCACAAATTATGTCATCAACATCAGGGCAATGTGGCGCTCATGTCTCCACATGCC[G/A]
TATCTCAATTACCTTCTCAAAGGTAATTGCCCAAGCATATAACATTTTATAAATATGAGTATGCATGATTCTAAAATAGCATTTCTAAGCAATTGTCATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.60% 0.21% 0.00% NA
All Indica  2759 83.90% 15.80% 0.25% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 58.00% 41.60% 0.37% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 77.80% 21.70% 0.43% 0.00% NA
Indica III  913 76.60% 23.20% 0.22% 0.00% NA
Indica Intermediate  786 86.10% 13.50% 0.38% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 35.60% 62.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226752550 C -> T LOC_Os02g44190.1 downstream_gene_variant ; 2429.0bp to feature; MODIFIER silent_mutation Average:28.715; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0226752550 C -> T LOC_Os02g44200.1 downstream_gene_variant ; 2377.0bp to feature; MODIFIER silent_mutation Average:28.715; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0226752550 C -> T LOC_Os02g44190-LOC_Os02g44200 intergenic_region ; MODIFIER silent_mutation Average:28.715; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226752550 NA 4.88E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 NA 3.55E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 1.39E-06 1.39E-06 mr1279_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 5.50E-06 5.49E-06 mr1313_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 3.95E-06 3.95E-06 mr1473_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 NA 7.11E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 1.21E-06 1.21E-06 mr1630_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 NA 4.18E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 9.67E-07 9.66E-07 mr1848_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 NA 4.47E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 NA 4.59E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226752550 NA 3.42E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251