\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226696579:

Variant ID: vg0226696579 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 26696579
Reference Allele: GAlternative Allele: A,GTCATGTAGA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAACAGTGCAAGCAAAAAAAATCAAAATCTCTTATATTATGAGACGGAGGAAGTATGTCAAAGTAAAGTTGGGATGCTAGTTTATACTAGATCTGTAG[G/A,GTCATGTAGA]
TGTCATGTGTACATCATATCATTTTAAGGGGCTGGAGCATGAGTGAAAATGTGAAATATACTGGTGTCATGTGTACTACGTACCTAGAGAGGCATGGAGA

Reverse complement sequence

TCTCCATGCCTCTCTAGGTACGTAGTACACATGACACCAGTATATTTCACATTTTCACTCATGCTCCAGCCCCTTAAAATGATATGATGTACACATGACA[C/T,TCTACATGAC]
CTACAGATCTAGTATAAACTAGCATCCCAACTTTACTTTGACATACTTCCTCCGTCTCATAATATAAGAGATTTTGATTTTTTTTGCTTGCACTGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.00% 0.63% 0.00% GTCATGTAGA: 0.02%
All Indica  2759 94.20% 5.80% 0.07% 0.00% NA
All Japonica  1512 63.80% 34.50% 1.65% 0.00% GTCATGTAGA: 0.07%
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 84.70% 15.10% 0.22% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 90.40% 8.00% 1.69% 0.00% NA
Tropical Japonica  504 29.80% 69.60% 0.60% 0.00% NA
Japonica Intermediate  241 50.60% 45.20% 3.73% 0.00% GTCATGTAGA: 0.41%
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 77.80% 18.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226696579 G -> A LOC_Os02g44132.2 upstream_gene_variant ; 1974.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0226696579 G -> A LOC_Os02g44132.1 upstream_gene_variant ; 1974.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0226696579 G -> A LOC_Os02g44130-LOC_Os02g44132 intergenic_region ; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0226696579 G -> GTCATGTAGA LOC_Os02g44132.2 upstream_gene_variant ; 1973.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0226696579 G -> GTCATGTAGA LOC_Os02g44132.1 upstream_gene_variant ; 1973.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0226696579 G -> GTCATGTAGA LOC_Os02g44130-LOC_Os02g44132 intergenic_region ; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226696579 NA 1.35E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 6.38E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 8.90E-09 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 6.13E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 4.78E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 1.66E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 8.52E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 1.72E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 4.55E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 8.19E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 3.61E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 2.04E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 3.37E-14 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 4.37E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 3.77E-06 2.58E-18 mr1864_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 1.76E-11 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 8.77E-09 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579 NA 2.75E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251