Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226696579:

Variant ID: vg0226696579 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 26696579
Reference Allele: G	Alternative Allele: A,GTCATGTAGA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAACAGTGCAAGCAAAAAAAATCAAAATCTCTTATATTATGAGACGGAGGAAGTATGTCAAAGTAAAGTTGGGATGCTAGTTTATACTAGATCTGTAG[G/A,GTCATGTAGA]
TGTCATGTGTACATCATATCATTTTAAGGGGCTGGAGCATGAGTGAAAATGTGAAATATACTGGTGTCATGTGTACTACGTACCTAGAGAGGCATGGAGA

Reverse complement sequence

TCTCCATGCCTCTCTAGGTACGTAGTACACATGACACCAGTATATTTCACATTTTCACTCATGCTCCAGCCCCTTAAAATGATATGATGTACACATGACA[C/T,TCTACATGAC]
CTACAGATCTAGTATAAACTAGCATCCCAACTTTACTTTGACATACTTCCTCCGTCTCATAATATAAGAGATTTTGATTTTTTTTGCTTGCACTGTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	15.00%	0.63%	0.00%	GTCATGTAGA: 0.02%
All Indica	2759	94.20%	5.80%	0.07%	0.00%	NA
All Japonica	1512	63.80%	34.50%	1.65%	0.00%	GTCATGTAGA: 0.07%
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	84.70%	15.10%	0.22%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	90.40%	8.00%	1.69%	0.00%	NA
Tropical Japonica	504	29.80%	69.60%	0.60%	0.00%	NA
Japonica Intermediate	241	50.60%	45.20%	3.73%	0.00%	GTCATGTAGA: 0.41%
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	77.80%	18.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226696579	G -> A	LOC_Os02g44132.2	upstream_gene_variant ; 1974.0bp to feature; MODIFIER	silent_mutation	Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0226696579	G -> A	LOC_Os02g44132.1	upstream_gene_variant ; 1974.0bp to feature; MODIFIER	silent_mutation	Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0226696579	G -> A	LOC_Os02g44130-LOC_Os02g44132	intergenic_region ; MODIFIER	silent_mutation	Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0226696579	G -> GTCATGTAGA	LOC_Os02g44132.2	upstream_gene_variant ; 1973.0bp to feature; MODIFIER	silent_mutation	Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0226696579	G -> GTCATGTAGA	LOC_Os02g44132.1	upstream_gene_variant ; 1973.0bp to feature; MODIFIER	silent_mutation	Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0226696579	G -> GTCATGTAGA	LOC_Os02g44130-LOC_Os02g44132	intergenic_region ; MODIFIER	silent_mutation	Average:54.528; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226696579	NA	1.35E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	6.38E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	8.90E-09	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	6.13E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	4.78E-09	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	1.66E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	8.52E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	1.72E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	4.55E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	8.19E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	3.61E-06	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	2.04E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	3.37E-14	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	4.37E-07	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	3.77E-06	2.58E-18	mr1864_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	1.76E-11	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	8.77E-09	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226696579	NA	2.75E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251