Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226588386:

Variant ID: vg0226588386 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26588386
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAAATTTTGTAATAACTTTATGAAACTACTAATGTGTAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATATCAAATTTTA[G/A]
TTATTTGTAAATTATATATATTTCTATGTGACGGAGCGTGGGGCTCCTCACCGGGAGACCGCGCAGGCCCCCCTTTGCCGGTTCGGCCGGGGACCCTGGG

Reverse complement sequence

CCCAGGGTCCCCGGCCGAACCGGCAAAGGGGGGCCTGCGCGGTCTCCCGGTGAGGAGCCCCACGCTCCGTCACATAGAAATATATATAATTTACAAATAA[C/T]
TAAAATTTGATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTACACATTAGTAGTTTCATAAAGTTATTACAAAATTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	8.50%	0.59%	0.00%	NA
All Indica	2759	91.80%	8.10%	0.07%	0.00%	NA
All Japonica	1512	94.10%	4.20%	1.65%	0.00%	NA
Aus	269	57.20%	42.40%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	81.10%	18.90%	0.00%	0.00%	NA
Indica III	913	90.80%	9.00%	0.22%	0.00%	NA
Indica Intermediate	786	93.10%	6.90%	0.00%	0.00%	NA
Temperate Japonica	767	90.50%	6.80%	2.74%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.20%	0.00%	NA
Japonica Intermediate	241	95.40%	3.30%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226588386	G -> A	LOC_Os02g44040.1	upstream_gene_variant ; 1531.0bp to feature; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0226588386	G -> A	LOC_Os02g44060.1	upstream_gene_variant ; 4053.0bp to feature; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0226588386	G -> A	LOC_Os02g44030.1	downstream_gene_variant ; 3863.0bp to feature; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0226588386	G -> A	LOC_Os02g44050.1	downstream_gene_variant ; 725.0bp to feature; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0226588386	G -> A	LOC_Os02g44040-LOC_Os02g44050	intergenic_region ; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226588386	NA	9.22E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226588386	7.18E-06	7.18E-06	mr1382_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226588386	4.05E-06	8.09E-06	mr1483_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226588386	NA	8.30E-06	mr1719_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226588386	NA	3.75E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226588386	NA	2.15E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226588386	NA	2.22E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226588386	2.69E-06	6.72E-08	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251