\
| Variant ID: vg0226545270 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 26545270 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
TCACTTTATATCTTCAGTTTTTCACAGTATTTTTTATAAGAGTTTACTGGGAATTCGATTTTAAACCTAGGGCTCAAGTCCTAACTCCTAACTGCTCCAC[C/G]
CTTGTCTTCCGCGTGAATTTGATTCCAATGAAACTATAGAATTTTCGTTCAATTAATTTTGGGTATTCTAGGGAGATTAAGCAAAGTGCCCACAACAATC
GATTGTTGTGGGCACTTTGCTTAATCTCCCTAGAATACCCAAAATTAATTGAACGAAAATTCTATAGTTTCATTGGAATCAAATTCACGCGGAAGACAAG[G/C]
GTGGAGCAGTTAGGAGTTAGGACTTGAGCCCTAGGTTTAAAATCGAATTCCCAGTAAACTCTTATAAAAAATACTGTGAAAAACTGAAGATATAAAGTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 10.30% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 3.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 75.40% | 23.90% | 0.66% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.70% | 11.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.80% | 10.20% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 62.50% | 37.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 59.80% | 39.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0226545270 | C -> G | LOC_Os02g43950.1 | downstream_gene_variant ; 311.0bp to feature; MODIFIER | silent_mutation | Average:50.756; most accessible tissue: Callus, score: 76.585 | N | N | N | N |
| vg0226545270 | C -> G | LOC_Os02g43960.1 | downstream_gene_variant ; 1202.0bp to feature; MODIFIER | silent_mutation | Average:50.756; most accessible tissue: Callus, score: 76.585 | N | N | N | N |
| vg0226545270 | C -> G | LOC_Os02g43950-LOC_Os02g43960 | intergenic_region ; MODIFIER | silent_mutation | Average:50.756; most accessible tissue: Callus, score: 76.585 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0226545270 | 1.77E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 1.48E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 6.81E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | 6.12E-07 | NA | mr1240 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 2.04E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | 6.72E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 8.87E-07 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 2.56E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | 1.24E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 8.84E-07 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | 9.15E-07 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 4.05E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 7.35E-07 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 2.55E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 2.63E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 5.99E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 1.06E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226545270 | NA | 2.44E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |