Variant ID: vg0226331103 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 26331103 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCGGATCAAACATGTCACCGGATCCGCGCCGTGATGCCTCGCCTCCAGAGTGATGGATGCCGAGCTCCGCCTAGTCGCTTGCTTTGGATCCGGCCTTCTC[G/A]
CCAGTTGTCGGCGCCGCATCTGACCTCCTCACCGCCGGATCGGCTCTACGCCGCCTCGCCGCCGGAGTGATGGATGTCGAGCTCCGCCCTGGCACCGGTG
CACCGGTGCCAGGGCGGAGCTCGACATCCATCACTCCGGCGGCGAGGCGGCGTAGAGCCGATCCGGCGGTGAGGAGGTCAGATGCGGCGCCGACAACTGG[C/T]
GAGAAGGCCGGATCCAAAGCAAGCGACTAGGCGGAGCTCGGCATCCATCACTCTGGAGGCGAGGCATCACGGCGCGGATCCGGTGACATGTTTGATCCGG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.70% | 2.40% | 0.91% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 89.70% | 7.40% | 2.84% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 80.10% | 14.60% | 5.35% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0226331103 | G -> A | LOC_Os02g43630.1 | upstream_gene_variant ; 1660.0bp to feature; MODIFIER | silent_mutation | Average:61.617; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
vg0226331103 | G -> A | LOC_Os02g43620.1 | downstream_gene_variant ; 4968.0bp to feature; MODIFIER | silent_mutation | Average:61.617; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
vg0226331103 | G -> A | LOC_Os02g43640.1 | downstream_gene_variant ; 4375.0bp to feature; MODIFIER | silent_mutation | Average:61.617; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
vg0226331103 | G -> A | LOC_Os02g43630-LOC_Os02g43640 | intergenic_region ; MODIFIER | silent_mutation | Average:61.617; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0226331103 | NA | 8.70E-06 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226331103 | NA | 6.83E-07 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226331103 | NA | 7.01E-06 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226331103 | NA | 6.16E-06 | mr1446_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226331103 | 2.20E-07 | 2.20E-07 | mr1499_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226331103 | NA | 8.41E-06 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |