\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226270478:

Variant ID: vg0226270478 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26270478
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CACGCACGCACCGCACCGCATGCATTGGTTGTGAGGCGGCGAGACGCGAGACTAGAGTTGAATTGTTATCTATAGGCTATGTATAAGAGATCCATGTCAC[C/T]
ATATTTTTCTACATGGAAGAGATTAAATGAAGAGAGAGAAAGCAAAGCTATCTACTAGTCTAGAGATAGTCTATAGAGAAAAACAAGGCAATGGATTAGA

Reverse complement sequence

TCTAATCCATTGCCTTGTTTTTCTCTATAGACTATCTCTAGACTAGTAGATAGCTTTGCTTTCTCTCTCTTCATTTAATCTCTTCCATGTAGAAAAATAT[G/A]
GTGACATGGATCTCTTATACATAGCCTATAGATAACAATTCAACTCTAGTCTCGCGTCTCGCCGCCTCACAACCAATGCATGCGGTGCGGTGCGTGCGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.00% 0.61% 0.19% NA
All Indica  2759 80.40% 19.20% 0.07% 0.29% NA
All Japonica  1512 90.80% 7.40% 1.79% 0.00% NA
Aus  269 32.00% 68.00% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 79.10% 20.20% 0.00% 0.65% NA
Indica III  913 70.20% 29.50% 0.22% 0.11% NA
Indica Intermediate  786 82.80% 16.70% 0.00% 0.51% NA
Temperate Japonica  767 83.20% 13.40% 3.39% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226270478 C -> T LOC_Os02g43540.1 upstream_gene_variant ; 1201.0bp to feature; MODIFIER silent_mutation Average:94.375; most accessible tissue: Minghui63 root, score: 98.354 N N N N
vg0226270478 C -> T LOC_Os02g43519.1 downstream_gene_variant ; 4654.0bp to feature; MODIFIER silent_mutation Average:94.375; most accessible tissue: Minghui63 root, score: 98.354 N N N N
vg0226270478 C -> T LOC_Os02g43530.1 downstream_gene_variant ; 2751.0bp to feature; MODIFIER silent_mutation Average:94.375; most accessible tissue: Minghui63 root, score: 98.354 N N N N
vg0226270478 C -> T LOC_Os02g43550.1 downstream_gene_variant ; 4892.0bp to feature; MODIFIER silent_mutation Average:94.375; most accessible tissue: Minghui63 root, score: 98.354 N N N N
vg0226270478 C -> T LOC_Os02g43530-LOC_Os02g43540 intergenic_region ; MODIFIER silent_mutation Average:94.375; most accessible tissue: Minghui63 root, score: 98.354 N N N N
vg0226270478 C -> DEL N N silent_mutation Average:94.375; most accessible tissue: Minghui63 root, score: 98.354 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0226270478 C T -0.02 0.0 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226270478 NA 7.80E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 6.46E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.26E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 9.64E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 2.39E-06 mr1208 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.63E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.74E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 4.83E-06 mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 6.74E-08 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.15E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 5.91E-07 mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.14E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 5.36E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 5.42E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 8.64E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 2.01E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.03E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 6.36E-06 6.36E-06 mr1562 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 4.76E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.58E-07 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 7.05E-06 mr1635 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 2.01E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 1.17E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226270478 NA 8.32E-07 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251