Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226148109:

Variant ID: vg0226148109 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26148109
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.08, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GTACTGACAACTGAATACAAACTGTTGAGCATTGACCTTGTTTTCCAGCATGTCTATGGAAGTACAAACAGATCTAACTACTTTTAAAGCCTTCATGTAT[T/A]
CCTTATTCCATGATTGCTCTATGAATTCCATAGTGCCGACTTGAAGTAATGTGTGAATGGAAGTGCAATACCGTAACTATTGTCATCTAGAATTATTGAA

Reverse complement sequence

TTCAATAATTCTAGATGACAATAGTTACGGTATTGCACTTCCATTCACACATTACTTCAAGTCGGCACTATGGAATTCATAGAGCAATCATGGAATAAGG[A/T]
ATACATGAAGGCTTTAAAAGTAGTTAGATCTGTTTGTACTTCCATAGACATGCTGGAAAACAAGGTCAATGCTCAACAGTTTGTATTCAGTTGTCAGTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.20%	0.02%	0.00%	NA
All Indica	2759	95.10%	4.80%	0.04%	0.00%	NA
All Japonica	1512	2.50%	97.50%	0.00%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	92.30%	7.60%	0.17%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	92.00%	8.00%	0.00%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	6.00%	94.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	38.90%	61.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226148109	T -> A	LOC_Os02g43330.1	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:50.635; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0226148109	T -> A	LOC_Os02g43340.1	intron_variant ; MODIFIER	silent_mutation	Average:50.635; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0226148109	T -> A	LOC_Os02g43340.2	intron_variant ; MODIFIER	silent_mutation	Average:50.635; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226148109	NA	5.71E-06	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	1.77E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	8.40E-24	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	2.24E-31	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	2.20E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	3.28E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	1.56E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	9.50E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	1.40E-24	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	3.30E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	8.31E-28	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	3.22E-18	mr1324_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	9.50E-14	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	2.81E-18	mr1333_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	7.46E-22	mr1336_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	4.36E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	6.30E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	1.96E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	1.02E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	3.73E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	1.15E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	2.17E-36	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226148109	NA	2.14E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251