Variant ID: vg0226125680 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 26125680 |
Reference Allele: T | Alternative Allele: A,C |
Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAAATTCGTCTCGCAGTTTCCTGGCGGAATCTGTAATTTGTTTTGTTATTAGAGTACGTTTAATACTTCAAATACGTGTCCGTATATCCGATGGGACAA[T/A,C]
CAAACTCAAAATTTTTCTTCAACTAAACAAGGCCAAAAGTATTCTGCACCACATGGTTGTTCTTATTGTGCCACCTGCTTAATTTCTTCTTTTGCAAAAA
TTTTTGCAAAAGAAGAAATTAAGCAGGTGGCACAATAAGAACAACCATGTGGTGCAGAATACTTTTGGCCTTGTTTAGTTGAAGAAAAATTTTGAGTTTG[A/T,G]
TTGTCCCATCGGATATACGGACACGTATTTGAAGTATTAAACGTACTCTAATAACAAAACAAATTACAGATTCCGCCAGGAAACTGCGAGACGAATTTAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.20% | 1.20% | 0.57% | 0.00% | C: 0.06% |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 94.50% | 3.60% | 1.72% | 0.00% | C: 0.20% |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.50% | 0.00% | 2.09% | 0.00% | C: 0.39% |
Tropical Japonica | 504 | 92.90% | 6.50% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 88.40% | 8.70% | 2.90% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0226125680 | T -> A | LOC_Os02g43314.1 | upstream_gene_variant ; 427.0bp to feature; MODIFIER | silent_mutation | Average:34.153; most accessible tissue: Callus, score: 69.363 | N | N | N | N |
vg0226125680 | T -> A | LOC_Os02g43310-LOC_Os02g43314 | intergenic_region ; MODIFIER | silent_mutation | Average:34.153; most accessible tissue: Callus, score: 69.363 | N | N | N | N |
vg0226125680 | T -> C | LOC_Os02g43314.1 | upstream_gene_variant ; 427.0bp to feature; MODIFIER | silent_mutation | Average:34.153; most accessible tissue: Callus, score: 69.363 | N | N | N | N |
vg0226125680 | T -> C | LOC_Os02g43310-LOC_Os02g43314 | intergenic_region ; MODIFIER | silent_mutation | Average:34.153; most accessible tissue: Callus, score: 69.363 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0226125680 | NA | 4.87E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | NA | 2.43E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | NA | 2.61E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | NA | 1.12E-06 | mr1944 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | NA | 8.66E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | NA | 8.10E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | 9.83E-07 | NA | mr1334_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | NA | 6.68E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0226125680 | NA | 9.98E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |