\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226125680:

Variant ID: vg0226125680 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26125680
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAATTCGTCTCGCAGTTTCCTGGCGGAATCTGTAATTTGTTTTGTTATTAGAGTACGTTTAATACTTCAAATACGTGTCCGTATATCCGATGGGACAA[T/A,C]
CAAACTCAAAATTTTTCTTCAACTAAACAAGGCCAAAAGTATTCTGCACCACATGGTTGTTCTTATTGTGCCACCTGCTTAATTTCTTCTTTTGCAAAAA

Reverse complement sequence

TTTTTGCAAAAGAAGAAATTAAGCAGGTGGCACAATAAGAACAACCATGTGGTGCAGAATACTTTTGGCCTTGTTTAGTTGAAGAAAAATTTTGAGTTTG[A/T,G]
TTGTCCCATCGGATATACGGACACGTATTTGAAGTATTAAACGTACTCTAATAACAAAACAAATTACAGATTCCGCCAGGAAACTGCGAGACGAATTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.20% 1.20% 0.57% 0.00% C: 0.06%
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.50% 3.60% 1.72% 0.00% C: 0.20%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 0.00% 2.09% 0.00% C: 0.39%
Tropical Japonica  504 92.90% 6.50% 0.60% 0.00% NA
Japonica Intermediate  241 88.40% 8.70% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226125680 T -> A LOC_Os02g43314.1 upstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:34.153; most accessible tissue: Callus, score: 69.363 N N N N
vg0226125680 T -> A LOC_Os02g43310-LOC_Os02g43314 intergenic_region ; MODIFIER silent_mutation Average:34.153; most accessible tissue: Callus, score: 69.363 N N N N
vg0226125680 T -> C LOC_Os02g43314.1 upstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:34.153; most accessible tissue: Callus, score: 69.363 N N N N
vg0226125680 T -> C LOC_Os02g43310-LOC_Os02g43314 intergenic_region ; MODIFIER silent_mutation Average:34.153; most accessible tissue: Callus, score: 69.363 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226125680 NA 4.87E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 NA 2.43E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 NA 2.61E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 NA 1.12E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 NA 8.66E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 NA 8.10E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 9.83E-07 NA mr1334_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 NA 6.68E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680 NA 9.98E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251