Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0226125680:

Variant ID: vg0226125680 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26125680
Reference Allele: T	Alternative Allele: A,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAATTCGTCTCGCAGTTTCCTGGCGGAATCTGTAATTTGTTTTGTTATTAGAGTACGTTTAATACTTCAAATACGTGTCCGTATATCCGATGGGACAA[T/A,C]
CAAACTCAAAATTTTTCTTCAACTAAACAAGGCCAAAAGTATTCTGCACCACATGGTTGTTCTTATTGTGCCACCTGCTTAATTTCTTCTTTTGCAAAAA

Reverse complement sequence

TTTTTGCAAAAGAAGAAATTAAGCAGGTGGCACAATAAGAACAACCATGTGGTGCAGAATACTTTTGGCCTTGTTTAGTTGAAGAAAAATTTTGAGTTTG[A/T,G]
TTGTCCCATCGGATATACGGACACGTATTTGAAGTATTAAACGTACTCTAATAACAAAACAAATTACAGATTCCGCCAGGAAACTGCGAGACGAATTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.20%	1.20%	0.57%	0.00%	C: 0.06%
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	94.50%	3.60%	1.72%	0.00%	C: 0.20%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	97.50%	0.00%	2.09%	0.00%	C: 0.39%
Tropical Japonica	504	92.90%	6.50%	0.60%	0.00%	NA
Japonica Intermediate	241	88.40%	8.70%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226125680	T -> A	LOC_Os02g43314.1	upstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:34.153; most accessible tissue: Callus, score: 69.363	N	N	N	N
vg0226125680	T -> A	LOC_Os02g43310-LOC_Os02g43314	intergenic_region ; MODIFIER	silent_mutation	Average:34.153; most accessible tissue: Callus, score: 69.363	N	N	N	N
vg0226125680	T -> C	LOC_Os02g43314.1	upstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:34.153; most accessible tissue: Callus, score: 69.363	N	N	N	N
vg0226125680	T -> C	LOC_Os02g43310-LOC_Os02g43314	intergenic_region ; MODIFIER	silent_mutation	Average:34.153; most accessible tissue: Callus, score: 69.363	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226125680	NA	4.87E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	NA	2.43E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	NA	2.61E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	NA	1.12E-06	mr1944	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	NA	8.66E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	NA	8.10E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	9.83E-07	NA	mr1334_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	NA	6.68E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226125680	NA	9.98E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251