\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226083118:

Variant ID: vg0226083118 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26083118
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AATGTGATTTCTCCTGCTTCTCGAGGAGTTGAACATAAATATGATAACCCCCGCAAATAAAAGTATGTACTCCCTCCATTTCATATTATAAGTCGTTTGG[T/C]
TTTTTCTCTAGTCAAACTTTTTTAAGTTTGATTAAATTTGTGAAAAAATATAATAGTATTTTTTAACTCAAGATAAACATATTATCAAAATATATGTAAT

Reverse complement sequence

ATTACATATATTTTGATAATATGTTTATCTTGAGTTAAAAAATACTATTATATTTTTTCACAAATTTAATCAAACTTAAAAAAGTTTGACTAGAGAAAAA[A/G]
CCAAACGACTTATAATATGAAATGGAGGGAGTACATACTTTTATTTGCGGGGGTTATCATATTTATGTTCAACTCCTCGAGAAGCAGGAGAAATCACATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.40% 13.60% 12.31% 36.61% NA
All Indica  2759 4.70% 20.50% 18.67% 56.11% NA
All Japonica  1512 97.60% 0.50% 0.40% 1.46% NA
Aus  269 6.30% 23.00% 17.47% 53.16% NA
Indica I  595 2.00% 19.50% 24.71% 53.78% NA
Indica II  465 3.00% 19.80% 19.78% 57.42% NA
Indica III  913 3.60% 20.30% 14.90% 61.23% NA
Indica Intermediate  786 9.00% 22.00% 17.81% 51.15% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 94.00% 1.40% 0.60% 3.97% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 95.80% 1.00% 2.08% 1.04% NA
Intermediate  90 60.00% 8.90% 13.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226083118 T -> DEL N N silent_mutation Average:34.733; most accessible tissue: Callus, score: 48.326 N N N N
vg0226083118 T -> C LOC_Os02g43280.1 intron_variant ; MODIFIER silent_mutation Average:34.733; most accessible tissue: Callus, score: 48.326 N N N N
vg0226083118 T -> C LOC_Os02g43280.2 intron_variant ; MODIFIER silent_mutation Average:34.733; most accessible tissue: Callus, score: 48.326 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226083118 NA 5.81E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 2.77E-06 4.09E-09 mr1042_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 5.80E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 7.64E-06 mr1185_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 9.16E-07 mr1269_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 6.18E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 8.06E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 5.14E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 1.65E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 4.74E-08 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 1.97E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 6.12E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 5.71E-06 mr1677_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 1.04E-06 1.04E-06 mr1680_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 2.16E-07 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 3.15E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 2.01E-06 6.67E-09 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 3.76E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 1.75E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 8.66E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 5.49E-06 5.49E-06 mr1919_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226083118 NA 2.13E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251