RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0226057933:

Variant ID: vg0226057933 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26057933
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACGCAATACTGAGGGAAACCCCCCTACGATCCCGTTCTGAACGACGATCTCGCACGATGGACAGAACGGTTACGGGAATCAGGGACCAACCTCAGCAAC[G/A]
CGTTCGAAGAGGCCGCTGCTGCAGCGCACCCGGAACAGCCACCAACTGGCGATGCTAATGGTGAAAACCCTGAACAGCGGGAATCGCCTCATCGAGCCAC

Reverse complement sequence

GTGGCTCGATGAGGCGATTCCCGCTGTTCAGGGTTTTCACCATTAGCATCGCCAGTTGGTGGCTGTTCCGGGTGCGCTGCAGCAGCGGCCTCTTCGAACG[C/T]
GTTGCTGAGGTTGGTCCCTGATTCCCGTAACCGTTCTGTCCATCGTGCGAGATCGTCGTTCAGAACGGGATCGTAGGGGGGTTTCCCTCAGTATTGCGTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.40%	1.60%	0.00%	0.00%	NA
All Indica	2759	97.40%	2.60%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	92.90%	7.10%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.80%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226057933	G -> A	LOC_Os02g43260.1	missense_variant ; p.Ala329Thr; MODERATE	nonsynonymous_codon ; A329T	Average:52.187; most accessible tissue: Zhenshan97 panicle, score: 72.468	benign	0.383	TOLERATED	0.17

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226057933	5.05E-10	3.39E-08	mr1033	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	6.35E-07	NA	mr1065	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	5.72E-06	NA	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	9.64E-07	7.83E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	3.72E-08	3.11E-09	mr1086	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	1.86E-06	7.03E-08	mr1088	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	3.93E-06	NA	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	1.29E-06	NA	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	3.90E-06	2.79E-06	mr1103	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226057933	1.69E-07	4.74E-09	mr1104	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 32 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0226057933:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact