\
| Variant ID: vg0226051634 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 26051634 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )
AGGATTCAAGATTTGAAACTTTCAACTCAAAATTTTTTTGATATTTTTAACTCAGATTTGAAAACTTTTAAGTCAAGATTTAAAAACTTTTCACTCGGAT[A/T]
TAAAAACTTACAATTTGAACTTGAAAACGTTTAACTCGGATTTAAAAACTTTCAACTCGGACTTGAAAACTTTTAACTTGGATTCAAAAACTTTCAAATG
CATTTGAAAGTTTTTGAATCCAAGTTAAAAGTTTTCAAGTCCGAGTTGAAAGTTTTTAAATCCGAGTTAAACGTTTTCAAGTTCAAATTGTAAGTTTTTA[T/A]
ATCCGAGTGAAAAGTTTTTAAATCTTGACTTAAAAGTTTTCAAATCTGAGTTAAAAATATCAAAAAAATTTTGAGTTGAAAGTTTCAAATCTTGAATCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 18.30% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.70% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 42.50% | 54.60% | 2.91% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 1.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 22.80% | 73.10% | 4.04% | 0.00% | NA |
| Tropical Japonica | 504 | 67.10% | 31.70% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.90% | 43.20% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 22.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0226051634 | A -> T | LOC_Os02g43220.1 | downstream_gene_variant ; 4953.0bp to feature; MODIFIER | silent_mutation | Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 | N | N | N | N |
| vg0226051634 | A -> T | LOC_Os02g43230.1 | downstream_gene_variant ; 3601.0bp to feature; MODIFIER | silent_mutation | Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 | N | N | N | N |
| vg0226051634 | A -> T | LOC_Os02g43250.1 | downstream_gene_variant ; 1186.0bp to feature; MODIFIER | silent_mutation | Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 | N | N | N | N |
| vg0226051634 | A -> T | LOC_Os02g43230-LOC_Os02g43250 | intergenic_region ; MODIFIER | silent_mutation | Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0226051634 | 2.74E-06 | 3.90E-13 | mr1013 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 4.53E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 1.62E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 9.87E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 2.28E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 2.57E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 8.73E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 4.99E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 3.93E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 7.93E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 3.54E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 2.52E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226051634 | NA | 5.32E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |