Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226051634:

Variant ID: vg0226051634 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26051634
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

AGGATTCAAGATTTGAAACTTTCAACTCAAAATTTTTTTGATATTTTTAACTCAGATTTGAAAACTTTTAAGTCAAGATTTAAAAACTTTTCACTCGGAT[A/T]
TAAAAACTTACAATTTGAACTTGAAAACGTTTAACTCGGATTTAAAAACTTTCAACTCGGACTTGAAAACTTTTAACTTGGATTCAAAAACTTTCAAATG

Reverse complement sequence

CATTTGAAAGTTTTTGAATCCAAGTTAAAAGTTTTCAAGTCCGAGTTGAAAGTTTTTAAATCCGAGTTAAACGTTTTCAAGTTCAAATTGTAAGTTTTTA[T/A]
ATCCGAGTGAAAAGTTTTTAAATCTTGACTTAAAAGTTTTCAAATCTGAGTTAAAAATATCAAAAAAATTTTGAGTTGAAAGTTTCAAATCTTGAATCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.60%	18.30%	1.10%	0.00%	NA
All Indica	2759	99.10%	0.70%	0.22%	0.00%	NA
All Japonica	1512	42.50%	54.60%	2.91%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	1.70%	0.64%	0.00%	NA
Temperate Japonica	767	22.80%	73.10%	4.04%	0.00%	NA
Tropical Japonica	504	67.10%	31.70%	1.19%	0.00%	NA
Japonica Intermediate	241	53.90%	43.20%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	22.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226051634	A -> T	LOC_Os02g43220.1	downstream_gene_variant ; 4953.0bp to feature; MODIFIER	silent_mutation	Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439	N	N	N	N
vg0226051634	A -> T	LOC_Os02g43230.1	downstream_gene_variant ; 3601.0bp to feature; MODIFIER	silent_mutation	Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439	N	N	N	N
vg0226051634	A -> T	LOC_Os02g43250.1	downstream_gene_variant ; 1186.0bp to feature; MODIFIER	silent_mutation	Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439	N	N	N	N
vg0226051634	A -> T	LOC_Os02g43230-LOC_Os02g43250	intergenic_region ; MODIFIER	silent_mutation	Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226051634	2.74E-06	3.90E-13	mr1013	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	4.53E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	1.62E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	9.87E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	2.28E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	2.57E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	8.73E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	4.99E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	3.93E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	7.93E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	3.54E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	2.52E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634	NA	5.32E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251