\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226051634:

Variant ID: vg0226051634 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26051634
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGGATTCAAGATTTGAAACTTTCAACTCAAAATTTTTTTGATATTTTTAACTCAGATTTGAAAACTTTTAAGTCAAGATTTAAAAACTTTTCACTCGGAT[A/T]
TAAAAACTTACAATTTGAACTTGAAAACGTTTAACTCGGATTTAAAAACTTTCAACTCGGACTTGAAAACTTTTAACTTGGATTCAAAAACTTTCAAATG

Reverse complement sequence

CATTTGAAAGTTTTTGAATCCAAGTTAAAAGTTTTCAAGTCCGAGTTGAAAGTTTTTAAATCCGAGTTAAACGTTTTCAAGTTCAAATTGTAAGTTTTTA[T/A]
ATCCGAGTGAAAAGTTTTTAAATCTTGACTTAAAAGTTTTCAAATCTGAGTTAAAAATATCAAAAAAATTTTGAGTTGAAAGTTTCAAATCTTGAATCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 18.30% 1.10% 0.00% NA
All Indica  2759 99.10% 0.70% 0.22% 0.00% NA
All Japonica  1512 42.50% 54.60% 2.91% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 1.70% 0.64% 0.00% NA
Temperate Japonica  767 22.80% 73.10% 4.04% 0.00% NA
Tropical Japonica  504 67.10% 31.70% 1.19% 0.00% NA
Japonica Intermediate  241 53.90% 43.20% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226051634 A -> T LOC_Os02g43220.1 downstream_gene_variant ; 4953.0bp to feature; MODIFIER silent_mutation Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 N N N N
vg0226051634 A -> T LOC_Os02g43230.1 downstream_gene_variant ; 3601.0bp to feature; MODIFIER silent_mutation Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 N N N N
vg0226051634 A -> T LOC_Os02g43250.1 downstream_gene_variant ; 1186.0bp to feature; MODIFIER silent_mutation Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 N N N N
vg0226051634 A -> T LOC_Os02g43230-LOC_Os02g43250 intergenic_region ; MODIFIER silent_mutation Average:66.757; most accessible tissue: Minghui63 flower, score: 90.439 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226051634 2.74E-06 3.90E-13 mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 4.53E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 1.62E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 9.87E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 2.28E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 2.57E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 8.73E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 4.99E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 3.93E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 7.93E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 3.54E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 2.52E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226051634 NA 5.32E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251