Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226049138:

Variant ID: vg0226049138 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26049138
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TGGATATCACGTGGCGCGGCCATCCCCACCACCAACCATGGAGATCTCTGCCGCCGCGCCCCCCTCCAGGCCGCCGCCGCTCCTCCTCCTCCGCCCGCTC[G/A]
CCTCCTCCTCGCCCGTCCCCCGTCACCGCCACCTCCTCCTCCATCACCATCAACCGCCGCCGCCCTTCCACCTCAGCCACCGCCACCGTCCGCCGCCGCG

Reverse complement sequence

CGCGGCGGCGGACGGTGGCGGTGGCTGAGGTGGAAGGGCGGCGGCGGTTGATGGTGATGGAGGAGGAGGTGGCGGTGACGGGGGACGGGCGAGGAGGAGG[C/T]
GAGCGGGCGGAGGAGGAGGAGCGGCGGCGGCCTGGAGGGGGGCGCGGCGGCAGAGATCTCCATGGTTGGTGGTGGGGATGGCCGCGCCACGTGATATCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 9.90% 3.62% 0.00% NA
All Indica  2759 77.00% 16.90% 6.09% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 65.00% 23.20% 11.76% 0.00% NA
Indica II  465 90.80% 5.20% 4.09% 0.00% NA
Indica III  913 73.90% 22.50% 3.61% 0.00% NA
Indica Intermediate  786 81.60% 12.60% 5.85% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226049138 G -> A LOC_Os02g43220.1 downstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:93.53; most accessible tissue: Minghui63 panicle, score: 97.355 N N N N
vg0226049138 G -> A LOC_Os02g43230.1 downstream_gene_variant ; 1105.0bp to feature; MODIFIER silent_mutation Average:93.53; most accessible tissue: Minghui63 panicle, score: 97.355 N N N N
vg0226049138 G -> A LOC_Os02g43250.1 downstream_gene_variant ; 3682.0bp to feature; MODIFIER silent_mutation Average:93.53; most accessible tissue: Minghui63 panicle, score: 97.355 N N N N
vg0226049138 G -> A LOC_Os02g43230-LOC_Os02g43250 intergenic_region ; MODIFIER silent_mutation Average:93.53; most accessible tissue: Minghui63 panicle, score: 97.355 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0226049138 G A 0.02 0.01 0.02 0.01 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226049138 NA 5.00E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 3.31E-06 NA mr1072 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 3.42E-06 4.78E-10 mr1072 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 7.88E-09 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 5.97E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 4.55E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 1.81E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 2.40E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 4.59E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 8.00E-06 NA mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 1.48E-07 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 8.86E-06 NA mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 3.68E-07 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 3.80E-09 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 1.00E-06 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226049138 NA 2.25E-10 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251