\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226041405:

Variant ID: vg0226041405 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26041405
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GGGATGCGATACGTTAAAATGCGATTGATTATCTGGTGGCTTCTTAATTTATAGCAGAGTGATCGTGAAGAATAGGAGGACCCGGTGCCACAAGACCCCC[A/G]
TATTCGACTAGAGATATAAAGTGGTTAAGGTACATGTATTATGTATTATATAGTAAAGTAGAACTCAATAATAATATACAATTTTTAGATAGGGATAAGG

Reverse complement sequence

CCTTATCCCTATCTAAAAATTGTATATTATTATTGAGTTCTACTTTACTATATAATACATAATACATGTACCTTAACCACTTTATATCTCTAGTCGAATA[T/C]
GGGGGTCTTGTGGCACCGGGTCCTCCTATTCTTCACGATCACTCTGCTATAAATTAAGAAGCCACCAGATAATCAATCGCATTTTAACGTATCGCATCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 9.90% 0.06% 0.00% NA
All Indica  2759 83.30% 16.60% 0.11% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.10% 6.90% 0.00% 0.00% NA
Indica II  465 69.20% 30.80% 0.00% 0.00% NA
Indica III  913 85.50% 14.20% 0.22% 0.00% NA
Indica Intermediate  786 81.70% 18.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226041405 A -> G LOC_Os02g43194.1 5_prime_UTR_variant ; 139.0bp to feature; MODIFIER silent_mutation Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0226041405 A -> G LOC_Os02g43210.1 upstream_gene_variant ; 955.0bp to feature; MODIFIER silent_mutation Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0226041405 A -> G LOC_Os02g43220.1 upstream_gene_variant ; 4620.0bp to feature; MODIFIER silent_mutation Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226041405 NA 1.66E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 NA 4.53E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 NA 3.67E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 NA 2.55E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 2.06E-06 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 2.12E-06 9.07E-09 mr1072_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 6.18E-07 NA mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 8.50E-07 2.15E-09 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 NA 2.73E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 NA 2.67E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405 NA 3.66E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251