Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226041405:

Variant ID: vg0226041405 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26041405
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

GGGATGCGATACGTTAAAATGCGATTGATTATCTGGTGGCTTCTTAATTTATAGCAGAGTGATCGTGAAGAATAGGAGGACCCGGTGCCACAAGACCCCC[A/G]
TATTCGACTAGAGATATAAAGTGGTTAAGGTACATGTATTATGTATTATATAGTAAAGTAGAACTCAATAATAATATACAATTTTTAGATAGGGATAAGG

Reverse complement sequence

CCTTATCCCTATCTAAAAATTGTATATTATTATTGAGTTCTACTTTACTATATAATACATAATACATGTACCTTAACCACTTTATATCTCTAGTCGAATA[T/C]
GGGGGTCTTGTGGCACCGGGTCCTCCTATTCTTCACGATCACTCTGCTATAAATTAAGAAGCCACCAGATAATCAATCGCATTTTAACGTATCGCATCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	9.90%	0.06%	0.00%	NA
All Indica	2759	83.30%	16.60%	0.11%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	93.10%	6.90%	0.00%	0.00%	NA
Indica II	465	69.20%	30.80%	0.00%	0.00%	NA
Indica III	913	85.50%	14.20%	0.22%	0.00%	NA
Indica Intermediate	786	81.70%	18.20%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226041405	A -> G	LOC_Os02g43194.1	5_prime_UTR_variant ; 139.0bp to feature; MODIFIER	silent_mutation	Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0226041405	A -> G	LOC_Os02g43210.1	upstream_gene_variant ; 955.0bp to feature; MODIFIER	silent_mutation	Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0226041405	A -> G	LOC_Os02g43220.1	upstream_gene_variant ; 4620.0bp to feature; MODIFIER	silent_mutation	Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226041405	NA	1.66E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	NA	4.53E-07	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	NA	3.67E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	NA	2.55E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	2.06E-06	NA	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	2.12E-06	9.07E-09	mr1072_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	6.18E-07	NA	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	8.50E-07	2.15E-09	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	NA	2.73E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	NA	2.67E-09	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226041405	NA	3.66E-07	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251