\
| Variant ID: vg0226041405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 26041405 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 123. )
GGGATGCGATACGTTAAAATGCGATTGATTATCTGGTGGCTTCTTAATTTATAGCAGAGTGATCGTGAAGAATAGGAGGACCCGGTGCCACAAGACCCCC[A/G]
TATTCGACTAGAGATATAAAGTGGTTAAGGTACATGTATTATGTATTATATAGTAAAGTAGAACTCAATAATAATATACAATTTTTAGATAGGGATAAGG
CCTTATCCCTATCTAAAAATTGTATATTATTATTGAGTTCTACTTTACTATATAATACATAATACATGTACCTTAACCACTTTATATCTCTAGTCGAATA[T/C]
GGGGGTCTTGTGGCACCGGGTCCTCCTATTCTTCACGATCACTCTGCTATAAATTAAGAAGCCACCAGATAATCAATCGCATTTTAACGTATCGCATCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 9.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 83.30% | 16.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.50% | 14.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 18.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0226041405 | A -> G | LOC_Os02g43194.1 | 5_prime_UTR_variant ; 139.0bp to feature; MODIFIER | silent_mutation | Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0226041405 | A -> G | LOC_Os02g43210.1 | upstream_gene_variant ; 955.0bp to feature; MODIFIER | silent_mutation | Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0226041405 | A -> G | LOC_Os02g43220.1 | upstream_gene_variant ; 4620.0bp to feature; MODIFIER | silent_mutation | Average:66.902; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0226041405 | NA | 1.66E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | NA | 4.53E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | NA | 3.67E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | NA | 2.55E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | 2.06E-06 | NA | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | 2.12E-06 | 9.07E-09 | mr1072_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | 6.18E-07 | NA | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | 8.50E-07 | 2.15E-09 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | NA | 2.73E-08 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | NA | 2.67E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226041405 | NA | 3.66E-07 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |