\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226024465:

Variant ID: vg0226024465 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26024465
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCTCTTTTTAATCGTCATTAGGATTCTATTTGGTGTTTTATTAACAATTTTTATATGTCGTACGAACCACCACCACTCTACTCCTTTATAGACCTGTT[T/A]
CTTAATTTATCTCGTCATGTGTTTTAGATGGTCTTTTCTTTCAATAGTCTTTATTTTTATCACAAATTTTAGTTATTTATAAATTGTATTCCTAATTGAA

Reverse complement sequence

TTCAATTAGGAATACAATTTATAAATAACTAAAATTTGTGATAAAAATAAAGACTATTGAAAGAAAAGACCATCTAAAACACATGACGAGATAAATTAAG[A/T]
AACAGGTCTATAAAGGAGTAGAGTGGTGGTGGTTCGTACGACATATAAAAATTGTTAATAAAACACCAAATAGAATCCTAATGACGATTAAAAAGAGGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.50% 0.11% 0.00% NA
All Indica  2759 97.60% 2.30% 0.04% 0.00% NA
All Japonica  1512 3.20% 96.60% 0.26% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.30% 0.13% 0.00% NA
Temperate Japonica  767 1.00% 98.60% 0.39% 0.00% NA
Tropical Japonica  504 6.30% 93.50% 0.20% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226024465 T -> A LOC_Os02g43160.1 upstream_gene_variant ; 2506.0bp to feature; MODIFIER silent_mutation Average:18.061; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0226024465 T -> A LOC_Os02g43170.1 upstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:18.061; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0226024465 T -> A LOC_Os02g43170.2 upstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:18.061; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0226024465 T -> A LOC_Os02g43160-LOC_Os02g43170 intergenic_region ; MODIFIER silent_mutation Average:18.061; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226024465 NA 1.61E-102 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 2.80E-101 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 7.99E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 9.10E-27 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 5.20E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.75E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.19E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 4.10E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 2.21E-46 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 5.09E-75 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 5.56E-29 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 8.32E-33 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 3.94E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.44E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.24E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 2.08E-44 mr1873 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 6.33E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 8.31E-27 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 4.66E-102 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.37E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 3.09E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.80E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 2.07E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.23E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.22E-33 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226024465 NA 1.17E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251