\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226014278:

Variant ID: vg0226014278 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 26014278
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.39, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCAATTTGCCGTTGAGAATTCGTAAGTACGCAGGCCATCTCGCGCGCGCAACTCGTGCGACGTTATTTTTTTAAAACAAAAGCAATTCTACGGTTCTT[G/A]
AGGAGGTATCATGAGGTACCAAAATTTTGGTACCTCATGATACCTCATACTACCTAGGTACCATGAGGTACCAAATTTTCAATAGAAAAAATAGTATTTC

Reverse complement sequence

GAAATACTATTTTTTCTATTGAAAATTTGGTACCTCATGGTACCTAGGTAGTATGAGGTATCATGAGGTACCAAAATTTTGGTACCTCATGATACCTCCT[C/T]
AAGAACCGTAGAATTGCTTTTGTTTTAAAAAAATAACGTCGCACGAGTTGCGCGCGCGAGATGGCCTGCGTACTTACGAATTCTCAACGGCAAATTGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 5.10% 3.85% 45.11% NA
All Indica  2759 18.80% 6.00% 5.87% 69.34% NA
All Japonica  1512 97.60% 0.00% 0.07% 2.38% NA
Aus  269 7.40% 26.80% 6.69% 59.11% NA
Indica I  595 3.50% 4.00% 5.71% 86.72% NA
Indica II  465 28.60% 8.40% 6.88% 56.13% NA
Indica III  913 20.00% 5.80% 4.82% 69.33% NA
Indica Intermediate  786 23.00% 6.40% 6.62% 63.99% NA
Temperate Japonica  767 99.50% 0.00% 0.00% 0.52% NA
Tropical Japonica  504 94.00% 0.00% 0.20% 5.75% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 95.80% 1.00% 0.00% 3.12% NA
Intermediate  90 71.10% 4.40% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226014278 G -> A LOC_Os02g43150-LOC_Os02g43160 intergenic_region ; MODIFIER silent_mutation Average:90.078; most accessible tissue: Callus, score: 98.594 N N N N
vg0226014278 G -> DEL N N silent_mutation Average:90.078; most accessible tissue: Callus, score: 98.594 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0226014278 G A 0.01 0.0 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0226014278 NA 9.13E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 7.17E-32 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 1.18E-28 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 9.74E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 4.36E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 2.25E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 8.54E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 4.90E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 1.12E-42 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 7.06E-44 mr1075_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 6.89E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 5.60E-26 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 4.57E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 2.96E-30 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 8.53E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 1.21E-08 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 1.25E-31 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 2.46E-19 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 1.45E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 2.63E-47 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226014278 NA 5.15E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251