Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226003155:

Variant ID: vg0226003155 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26003155
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

AACACAGGAAAAATATAGGAATGGTCGTTTGATTAGAGCGCAGGAAAAACGCAGGAATCGAATGAGAGAGATAGACTCAAAGGGAATTTTTCAAGAGGTT[G/A]
GAGCTCTTGCTAAATTTCCTCCAAAATCCACATGCAATATATCATTCCATAGGAATTTCATAGGATTTGGAAAGCTTCAATCCTTTGAATCAAAGGGCCA

Reverse complement sequence

TGGCCCTTTGATTCAAAGGATTGAAGCTTTCCAAATCCTATGAAATTCCTATGGAATGATATATTGCATGTGGATTTTGGAGGAAATTTAGCAAGAGCTC[C/T]
AACCTCTTGAAAAATTCCCTTTGAGTCTATCTCTCTCATTCGATTCCTGCGTTTTTCCTGCGCTCTAATCAAACGACCATTCCTATATTTTTCCTGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	11.70%	0.04%	0.00%	NA
All Indica	2759	80.40%	19.60%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.30%	8.70%	0.00%	0.00%	NA
Indica II	465	66.90%	33.10%	0.00%	0.00%	NA
Indica III	913	81.60%	18.30%	0.11%	0.00%	NA
Indica Intermediate	786	78.60%	21.20%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226003155	G -> A	LOC_Os02g43150.1	downstream_gene_variant ; 3979.0bp to feature; MODIFIER	silent_mutation	Average:28.491; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0226003155	G -> A	LOC_Os02g43150.2	downstream_gene_variant ; 3979.0bp to feature; MODIFIER	silent_mutation	Average:28.491; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0226003155	G -> A	LOC_Os02g43150-LOC_Os02g43160	intergenic_region ; MODIFIER	silent_mutation	Average:28.491; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226003155	NA	2.73E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	6.18E-08	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	9.84E-08	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	4.14E-07	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	4.82E-07	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	2.43E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	1.06E-06	NA	mr1072_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	1.11E-06	5.40E-10	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	1.95E-07	NA	mr1075_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	2.55E-07	3.40E-11	mr1075_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	9.25E-06	NA	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	4.08E-06	5.71E-10	mr1077_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	3.70E-10	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	2.38E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	3.25E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	9.74E-06	NA	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226003155	NA	6.73E-08	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251