\
| Variant ID: vg0225999747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25999747 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )
AACAAATAAAAAATCTGAATTATATGAACGATTTTCTGTTTACCCCATTCAAATCAACCGGCTTAATTAAATTATATTGTCTAGAAATTGAGAAAAAGTC[G/T]
CATTGAATTTTATTGCAAGAACTTGAGAAAGAAAATCGTTCTCCCGTAAATAAACACTGCTAATACGGTTGAAACAAGATACTCCCTCCGTCCCATAATA
TATTATGGGACGGAGGGAGTATCTTGTTTCAACCGTATTAGCAGTGTTTATTTACGGGAGAACGATTTTCTTTCTCAAGTTCTTGCAATAAAATTCAATG[C/A]
GACTTTTTCTCAATTTCTAGACAATATAATTTAATTAAGCCGGTTGATTTGAATGGGGTAAACAGAAAATCGTTCATATAATTCAGATTTTTTATTTGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 3.90% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 92.10% | 6.60% | 1.27% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.40% | 21.70% | 3.87% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 88.50% | 9.50% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225999747 | G -> T | LOC_Os02g43150.1 | downstream_gene_variant ; 571.0bp to feature; MODIFIER | silent_mutation | Average:45.315; most accessible tissue: Callus, score: 71.622 | N | N | N | N |
| vg0225999747 | G -> T | LOC_Os02g43150.2 | downstream_gene_variant ; 571.0bp to feature; MODIFIER | silent_mutation | Average:45.315; most accessible tissue: Callus, score: 71.622 | N | N | N | N |
| vg0225999747 | G -> T | LOC_Os02g43150-LOC_Os02g43160 | intergenic_region ; MODIFIER | silent_mutation | Average:45.315; most accessible tissue: Callus, score: 71.622 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225999747 | NA | 2.33E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 2.34E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | 2.49E-06 | NA | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | 6.67E-06 | 2.01E-09 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | 5.57E-06 | NA | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 1.17E-09 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 1.15E-09 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | 4.12E-07 | NA | mr1124_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | 1.93E-07 | 3.62E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 4.48E-08 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 1.13E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 1.77E-07 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 9.85E-06 | mr1497_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 5.93E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | 8.36E-06 | NA | mr1861_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 5.11E-10 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 6.63E-06 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225999747 | NA | 6.63E-06 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |